EMAIL THIS PAGE TO A FRIEND

PKLR

pyruvate kinase, liver and RBC

80 Gene Product Result for
Synonyms: PK1 PKL PKR PKRL RPK
UniProtKB ID: P30613, P11973
Gene ID:
Human(5313) Summary: The protein encoded by this gene is a pyruvate kinase that catalyzes the transphosphorylation of phohsphoenolpyruvate into pyruvate and ATP, which is the rate-limiting step of glycolysis. Defects in this enzyme, due to gene mutations or genetic variations, are the common cause of chronic hereditary nonspherocytic hemolytic anemia (CNSHA or HNSHA). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18770) pyruvate kinase liver and red blood cell
Rat(24651) pyruvate kinase, liver and RBC
Zebrafish(114551) pyruvate kinase, liver and RBC
domestic cat(100750244) pyruvate kinase deficiency
domestic cat(101088459) pyruvate kinase, liver and RBC
dog(490425) pyruvate kinase, liver and RBC
domestic guinea pig(100716756) pyruvate kinase, liver and RBC
naked mole-rat(101701016) pyruvate kinase, liver and RBC
Domestic Rabbit(100355056) pyruvate kinase, liver and RBC
cow(539579) pyruvate kinase, liver and RBC
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK071 Pyruvate Assay Kit sufficient for 100 colorimetric or fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000298 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000298 Rosetta Predictions human pricing
NM_181871 Rosetta Predictions human pricing
NM_012624 Rosetta Predictions rat pricing
NM_001099779 Rosetta Predictions mouse pricing
NM_013631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061571 predicted 1974
2 SASI_Hs01_00061572 predicted 1967
3 SASI_Hs01_00061573 predicted 1849
4 SASI_Hs01_00061574 predicted 2051
5 SASI_Hs01_00061575 predicted 1894
6 SASI_Hs01_00061576 predicted 1580
7 SASI_Hs01_00061577 predicted 2048
8 SASI_Hs01_00061578 predicted 1196
9 SASI_Hs01_00061579 predicted 1727
10 SASI_Hs01_00061580 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100321 predicted 1953
2 SASI_Hs01_00100322 predicted 1954
3 SASI_Hs01_00100323 predicted 1829
4 SASI_Hs01_00100324 predicted 2028
5 SASI_Hs01_00100325 predicted 1878
6 SASI_Hs01_00100326 predicted 1565
7 SASI_Hs01_00100327 predicted 2038
8 SASI_Hs01_00100328 predicted 1173
9 SASI_Hs01_00100329 predicted 1708
10 SASI_Hs01_00100330 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259828 predicted 1675
2 SASI_Rn02_00259829 predicted 1208
3 SASI_Rn02_00259830 predicted 1367
4 SASI_Rn02_00259831 predicted 250
5 SASI_Rn02_00259832 predicted 1513
6 SASI_Rn02_00259833 predicted 1327
7 SASI_Rn02_00259834 predicted 442
8 SASI_Rn02_00259835 predicted 510
9 SASI_Rn02_00259836 predicted 1391
10 SASI_Rn02_00259837 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302025 predicted 578
2 SASI_Mm02_00302026 predicted 1200
3 SASI_Mm02_00302027 predicted 1518
4 SASI_Mm02_00302028 predicted 697
5 SASI_Mm02_00302029 predicted 240
6 SASI_Mm02_00302030 predicted 1387
7 SASI_Mm02_00302031 predicted 1504
8 SASI_Mm02_00302032 predicted 502
9 SASI_Mm02_00302033 predicted 1523
10 SASI_Mm02_00302034 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191042 predicted 703
2 SASI_Mm01_00191043 predicted 1328
3 SASI_Mm02_00322410 predicted 1639
4 SASI_Mm01_00191044 predicted 823
5 SASI_Mm01_00191046 predicted 363
6 SASI_Mm01_00191047 predicted 1517
7 SASI_Mm02_00322411 predicted 1635
8 SASI_Mm02_00322412 predicted 624
9 SASI_Mm02_00322413 predicted 1647
10 SASI_Mm02_00322414 predicted 1132
11 SASI_Mm01_00191045 predicted 231
12 SASI_Mm01_00191048 predicted 877
13 SASI_Mm01_00191049 predicted 1203
14 SASI_Mm01_00191050 predicted 771
15 SASI_Mm01_00191051 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013631
VALIDATED
PKLR MISSION shRNA Bacterial Glycerol Stock
pyruvate kinase, liver and RBC
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1908s21c1
Sequence:CCGGCCAGCAGCATCAGTCGTATATCTCGAGATATACGACTGATGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1723s21c1
Sequence:CCGGGCTCTGGCTATACCAACATTACTCGAGTAATGTTGGTATAGCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1293s21c1
Sequence:CCGGGTAAAGATGCAACATGCGATTCTCGAGAATCGCATGTTGCATCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013631.2-1344s21c1
Sequence:CCGGCGCCAGTTGTTTGAGGAGCTACTCGAGTAGCTCCTCAAACAACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013631.1-82s1c1
Sequence:CCGGCCTGGATCTTTAAGTCCCAAACTCGAGTTTGGGACTTAAAGATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1293s1c1
Sequence:CCGGGTAAAGATGCAACATGCGATTCTCGAGAATCGCATGTTGCATCTTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1160s1c1
Sequence:CCGGGCTGGAGAGCATGATCACTAACTCGAGTTAGTGATCATGCTCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1344s1c1
Sequence:CCGGCGCCAGTTGTTTGAGGAGCTACTCGAGTAGCTCCTCAAACAACTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-641s1c1
Sequence:CCGGGTGGGTGGACTACCACAATATCTCGAGATATTGTGGTAGTCCACCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1875s21c1
Sequence:CCGGCTGAATGTCTGGGTCCAATTACTCGAGTAATTGGACCCAGACATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1160s21c1
Sequence:CCGGGCTGGAGAGCATGATCACTAACTCGAGTTAGTGATCATGCTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013631
VALIDATED
PKLR MISSION shRNA shRNA Plasmid DNA
pyruvate kinase, liver and RBC
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1908s21c1
Sequence:CCGGCCAGCAGCATCAGTCGTATATCTCGAGATATACGACTGATGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1723s21c1
Sequence:CCGGGCTCTGGCTATACCAACATTACTCGAGTAATGTTGGTATAGCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1293s21c1
Sequence:CCGGGTAAAGATGCAACATGCGATTCTCGAGAATCGCATGTTGCATCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013631.2-1344s21c1
Sequence:CCGGCGCCAGTTGTTTGAGGAGCTACTCGAGTAGCTCCTCAAACAACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013631.1-82s1c1
Sequence:CCGGCCTGGATCTTTAAGTCCCAAACTCGAGTTTGGGACTTAAAGATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1293s1c1
Sequence:CCGGGTAAAGATGCAACATGCGATTCTCGAGAATCGCATGTTGCATCTTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1160s1c1
Sequence:CCGGGCTGGAGAGCATGATCACTAACTCGAGTTAGTGATCATGCTCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1344s1c1
Sequence:CCGGCGCCAGTTGTTTGAGGAGCTACTCGAGTAGCTCCTCAAACAACTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-641s1c1
Sequence:CCGGGTGGGTGGACTACCACAATATCTCGAGATATTGTGGTAGTCCACCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1875s21c1
Sequence:CCGGCTGAATGTCTGGGTCCAATTACTCGAGTAATTGGACCCAGACATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1160s21c1
Sequence:CCGGGCTGGAGAGCATGATCACTAACTCGAGTTAGTGATCATGCTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013631
VALIDATED
PKLR MISSION shRNA Lentiviral Transduction Particles
pyruvate kinase, liver and RBC
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1908s21c1
Sequence:CCGGCCAGCAGCATCAGTCGTATATCTCGAGATATACGACTGATGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1723s21c1
Sequence:CCGGGCTCTGGCTATACCAACATTACTCGAGTAATGTTGGTATAGCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1293s21c1
Sequence:CCGGGTAAAGATGCAACATGCGATTCTCGAGAATCGCATGTTGCATCTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013631.2-1344s21c1
Sequence:CCGGCGCCAGTTGTTTGAGGAGCTACTCGAGTAGCTCCTCAAACAACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013631.1-82s1c1
Sequence:CCGGCCTGGATCTTTAAGTCCCAAACTCGAGTTTGGGACTTAAAGATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1293s1c1
Sequence:CCGGGTAAAGATGCAACATGCGATTCTCGAGAATCGCATGTTGCATCTTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1160s1c1
Sequence:CCGGGCTGGAGAGCATGATCACTAACTCGAGTTAGTGATCATGCTCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-1344s1c1
Sequence:CCGGCGCCAGTTGTTTGAGGAGCTACTCGAGTAGCTCCTCAAACAACTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013631.1-641s1c1
Sequence:CCGGGTGGGTGGACTACCACAATATCTCGAGATATTGTGGTAGTCCACCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1875s21c1
Sequence:CCGGCTGAATGTCTGGGTCCAATTACTCGAGTAATTGGACCCAGACATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013631.2-1160s21c1
Sequence:CCGGGCTGGAGAGCATGATCACTAACTCGAGTTAGTGATCATGCTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000298
PKLR MISSION shRNA Bacterial Glycerol Stock
pyruvate kinase, liver and RBC
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000298.4-2043s1c1
Sequence:CCGGCTAAGATGCCTTGAGTCTTTACTCGAGTAAAGACTCAAGGCATCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-1376s1c1
Sequence:CCGGCCCACTGAGGTCACCGCCATTCTCGAGAATGGCGGTGACCTCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-638s1c1
Sequence:CCGGCCCAATATTGTCCGGGTCGTGCTCGAGCACGACCCGGACAATATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-221s1c1
Sequence:CCGGGCAGACACCTTCCTGGAACACCTCGAGGTGTTCCAGGAAGGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-1632s1c1
Sequence:CCGGGCATTGAAAGTGGAAAGCTCCCTCGAGGGAGCTTTCCACTTTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-72s1c1
Sequence:CCGGGCTTCGGTCATGGGTCTCTAACTCGAGTTAGAGACCCATGACCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-1633s1c1
Sequence:CCGGCGGGTGCAATTTGGCATTGAACTCGAGTTCAATGCCAAATTGCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000298.3-1854s1c1
Sequence:CCGGCCCACCTTTAAGTCCTCTCTTCTCGAGAAGAGAGGACTTAAAGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-996s1c1
Sequence:CCGGCGTGAAGAGGTTTGATGAAATCTCGAGATTTCATCAAACCTCTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-1158s1c1
Sequence:CCGGGCTGGAGAGCATGATTACCAACTCGAGTTGGTAATCATGCTCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000298
PKLR MISSION shRNA shRNA Plasmid DNA
pyruvate kinase, liver and RBC
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000298.4-2043s1c1
Sequence:CCGGCTAAGATGCCTTGAGTCTTTACTCGAGTAAAGACTCAAGGCATCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-1376s1c1
Sequence:CCGGCCCACTGAGGTCACCGCCATTCTCGAGAATGGCGGTGACCTCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-638s1c1
Sequence:CCGGCCCAATATTGTCCGGGTCGTGCTCGAGCACGACCCGGACAATATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-221s1c1
Sequence:CCGGGCAGACACCTTCCTGGAACACCTCGAGGTGTTCCAGGAAGGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-1632s1c1
Sequence:CCGGGCATTGAAAGTGGAAAGCTCCCTCGAGGGAGCTTTCCACTTTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-72s1c1
Sequence:CCGGGCTTCGGTCATGGGTCTCTAACTCGAGTTAGAGACCCATGACCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-1633s1c1
Sequence:CCGGCGGGTGCAATTTGGCATTGAACTCGAGTTCAATGCCAAATTGCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000298.3-1854s1c1
Sequence:CCGGCCCACCTTTAAGTCCTCTCTTCTCGAGAAGAGAGGACTTAAAGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-996s1c1
Sequence:CCGGCGTGAAGAGGTTTGATGAAATCTCGAGATTTCATCAAACCTCTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-1158s1c1
Sequence:CCGGGCTGGAGAGCATGATTACCAACTCGAGTTGGTAATCATGCTCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000298
PKLR MISSION shRNA Lentiviral Transduction Particles
pyruvate kinase, liver and RBC
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000298.4-2043s1c1
Sequence:CCGGCTAAGATGCCTTGAGTCTTTACTCGAGTAAAGACTCAAGGCATCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-1376s1c1
Sequence:CCGGCCCACTGAGGTCACCGCCATTCTCGAGAATGGCGGTGACCTCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-638s1c1
Sequence:CCGGCCCAATATTGTCCGGGTCGTGCTCGAGCACGACCCGGACAATATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-221s1c1
Sequence:CCGGGCAGACACCTTCCTGGAACACCTCGAGGTGTTCCAGGAAGGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.4-1632s1c1
Sequence:CCGGGCATTGAAAGTGGAAAGCTCCCTCGAGGGAGCTTTCCACTTTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-72s1c1
Sequence:CCGGGCTTCGGTCATGGGTCTCTAACTCGAGTTAGAGACCCATGACCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-1633s1c1
Sequence:CCGGCGGGTGCAATTTGGCATTGAACTCGAGTTCAATGCCAAATTGCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000298.3-1854s1c1
Sequence:CCGGCCCACCTTTAAGTCCTCTCTTCTCGAGAAGAGAGGACTTAAAGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-996s1c1
Sequence:CCGGCGTGAAGAGGTTTGATGAAATCTCGAGATTTCATCAAACCTCTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000298.3-1158s1c1
Sequence:CCGGGCTGGAGAGCATGATTACCAACTCGAGTTGGTAATCATGCTCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)