EMAIL THIS PAGE TO A FRIEND

PKM

pyruvate kinase, muscle

113 Gene Product Result for
Synonyms: CTHBP OIP3 PK3 PKM2 TCB THBP1
Gene ID:
Human(5315) Summary: This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011]
Mouse(18746) pyruvate kinase, muscle
Rat(25630) pyruvate kinase, muscle
cow(512571) pyruvate kinase, muscle
sheep(101109180) pyruvate kinase, muscle
Domestic Rabbit(100008676) pyruvate kinase, muscle
naked mole-rat(101721034) pyruvate kinase, muscle
domestic guinea pig(100736056) pyruvate kinase, muscle
Horse(100063687) pyruvate kinase, muscle
domestic cat(101092521) pyruvate kinase, muscle
dog(403874) pyruvate kinase, muscle
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029501 Anti-PKM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305407 ANTI-PKM1 (C-TERM L398) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB4300663 Anti-PKM1 antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4200105 Anti-PKM2 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human, rat, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4200094 Anti-PKM2 (isoform M1) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human, rat, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4200095 Anti-PKM2 (isoform M2) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4300662 Anti-PKM2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0005315M1 Monoclonal Anti-PKM2 antibody produced in mouse clone 5D2-3B3, ascites fluid human
ELISA, western blot pricing
SAB1404212 Monoclonal Anti-PKM2, (C-terminal) antibody produced in mouse clone 2D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
PLA0286 Rabbit anti-PKM2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rat, dog, zebrafish, rabbit, mouse, human, guinea pig, toad, toad, bovine, turkey, chicken, horse
immunoprecipitation (IP), proximity ligation assay, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK071 Pyruvate Assay Kit sufficient for 100 colorimetric or fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002654 Rosetta Predictions human pricing
NM_182470 Rosetta Predictions human pricing
NM_182471 Rosetta Predictions human pricing
NM_053297 Rosetta Predictions rat pricing
NM_011099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024879 predicted 764
2 SASI_Hs01_00024880 predicted 672
3 SASI_Hs01_00024884 predicted 773
4 SASI_Hs01_00024886 predicted 1110
5 SASI_Hs01_00024887 predicted 636
6 SASI_Hs02_00334198 predicted 1123
7 SASI_Hs02_00334199 predicted 887
8 SASI_Hs02_00334200 predicted 1112
9 SASI_Hs01_00024881 predicted 438
10 SASI_Hs01_00024883 predicted 976
11 SASI_Hs01_00024882 predicted 1029
12 SASI_Hs01_00024885 predicted 748
13 SASI_Hs01_00024888 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140744 predicted 981
2 SASI_Hs01_00140745 predicted 880
3 SASI_Hs01_00140749 predicted 993
4 SASI_Hs01_00140751 predicted 1321
5 SASI_Hs01_00140752 predicted 853
6 SASI_Hs02_00370486 predicted 1331
7 SASI_Hs02_00370487 predicted 1112
8 SASI_Hs02_00370488 predicted 1337
9 SASI_Hs01_00140746 predicted 659
10 SASI_Hs01_00140748 predicted 1196
11 SASI_Hs01_00140747 predicted 1236
12 SASI_Hs01_00140750 predicted 970
13 SASI_Hs01_00140753 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217689 predicted 758
2 SASI_Hs01_00217690 predicted 668
3 SASI_Hs01_00217694 predicted 778
4 SASI_Hs01_00217696 predicted 1102
5 SASI_Hs01_00217697 predicted 644
6 SASI_Hs02_00370489 predicted 1117
7 SASI_Hs02_00370490 predicted 895
8 SASI_Hs02_00370491 predicted 1115
9 SASI_Hs01_00217691 predicted 436
10 SASI_Hs01_00217693 predicted 980
11 SASI_Hs01_00217692 predicted 1023
12 SASI_Hs01_00217695 predicted 749
13 SASI_Hs01_00217698 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106843 predicted 1358
2 SASI_Rn01_00106844 predicted 1220
3 SASI_Rn01_00106845 predicted 1045
4 SASI_Rn01_00106847 predicted 268
5 SASI_Rn02_00265679 predicted 1595
6 SASI_Rn01_00106849 predicted 284
7 SASI_Rn01_00106850 predicted 363
8 SASI_Rn02_00265680 predicted 450
9 SASI_Rn02_00265681 predicted 862
10 SASI_Rn02_00265682 predicted 652
11 SASI_Rn01_00106846 predicted 439
12 SASI_Rn01_00106848 predicted 353
13 SASI_Rn01_00106851 predicted 1548
14 SASI_Rn01_00106852 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036290 predicted 1331
2 SASI_Mm01_00036291 predicted 821
3 SASI_Mm01_00036292 predicted 402
4 SASI_Mm01_00036293 predicted 616
5 SASI_Mm02_00319889 predicted 274
6 SASI_Mm02_00319890 predicted 886
7 SASI_Mm01_00036294 predicted 1568
8 SASI_Mm01_00036295 predicted 253
9 SASI_Mm01_00036296 predicted 327
10 SASI_Mm01_00036297 predicted 1209
11 SASI_Mm01_00036298 predicted 426
12 SASI_Mm01_00036299 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182471
VALIDATED
PKM MISSION shRNA Bacterial Glycerol Stock
pyruvate kinase, muscle
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182471.1-1915s1c1
Sequence:CCGGGAACTCACTCTGGGCTGTAACCTCGAGGTTACAGCCCAGAGTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-2128s1c1
Sequence:CCGGCTTTCCTGTGTGTACTCTGTCCTCGAGGACAGAGTACACACAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182471.1-2206s1c1
Sequence:CCGGGAAACAGCCAGCAAGAGTTAGCTCGAGCTAACTCTTGCTGGCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1070s1c1
Sequence:CCGGGTTCGGAGGTTTGATGAAATCCTCGAGGATTTCATCAAACCTCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-766s1c1
Sequence:CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182471.1-1904s1c1
Sequence:CCGGCAACGCTTGTAGAACTCACTCCTCGAGGAGTGAGTTCTACAAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1736s1c1
Sequence:CCGGGCCCGAGGCTTCTTCAAGAAGCTCGAGCTTCTTGAAGAAGCCTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1415s1c1
Sequence:CCGGCGCAAGCTGTTTGAAGAACTTCTCGAGAAGTTCTTCAAACAGCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1021s1c1
Sequence:CCGGGAAGGGAAAGAACATCAAGATCTCGAGATCTTGATGTTCTTTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-566s1c1
Sequence:CCGGGCTGTGGCTCTAGACACTAAACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1493s1c1
Sequence:CCGGGAGGCTTCTTATAAGTGTTTACTCGAGTAAACACTTATAAGAAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1706s1c1
Sequence:CCGGCGGGTGAACTTTGCCATGAATCTCGAGATTCATGGCAAAGTTCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-566s21c1
Sequence:CCGGGCTGTGGCTCTAGACACTAAACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-1070s21c1
Sequence:CCGGGTTCGGAGGTTTGATGAAATCCTCGAGGATTTCATCAAACCTCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-1904s21c1
Sequence:CCGGCAACGCTTGTAGAACTCACTCCTCGAGGAGTGAGTTCTACAAGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-766s21c1
Sequence:CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182471
VALIDATED
PKM MISSION shRNA shRNA Plasmid DNA
pyruvate kinase, muscle
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182471.1-1915s1c1
Sequence:CCGGGAACTCACTCTGGGCTGTAACCTCGAGGTTACAGCCCAGAGTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-2128s1c1
Sequence:CCGGCTTTCCTGTGTGTACTCTGTCCTCGAGGACAGAGTACACACAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182471.1-2206s1c1
Sequence:CCGGGAAACAGCCAGCAAGAGTTAGCTCGAGCTAACTCTTGCTGGCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1070s1c1
Sequence:CCGGGTTCGGAGGTTTGATGAAATCCTCGAGGATTTCATCAAACCTCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-766s1c1
Sequence:CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182471.1-1904s1c1
Sequence:CCGGCAACGCTTGTAGAACTCACTCCTCGAGGAGTGAGTTCTACAAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1736s1c1
Sequence:CCGGGCCCGAGGCTTCTTCAAGAAGCTCGAGCTTCTTGAAGAAGCCTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1415s1c1
Sequence:CCGGCGCAAGCTGTTTGAAGAACTTCTCGAGAAGTTCTTCAAACAGCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1021s1c1
Sequence:CCGGGAAGGGAAAGAACATCAAGATCTCGAGATCTTGATGTTCTTTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-566s1c1
Sequence:CCGGGCTGTGGCTCTAGACACTAAACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1493s1c1
Sequence:CCGGGAGGCTTCTTATAAGTGTTTACTCGAGTAAACACTTATAAGAAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1706s1c1
Sequence:CCGGCGGGTGAACTTTGCCATGAATCTCGAGATTCATGGCAAAGTTCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-566s21c1
Sequence:CCGGGCTGTGGCTCTAGACACTAAACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-1070s21c1
Sequence:CCGGGTTCGGAGGTTTGATGAAATCCTCGAGGATTTCATCAAACCTCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-1904s21c1
Sequence:CCGGCAACGCTTGTAGAACTCACTCCTCGAGGAGTGAGTTCTACAAGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-766s21c1
Sequence:CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182471
VALIDATED
PKM MISSION shRNA Lentiviral Transduction Particles
pyruvate kinase, muscle
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182471.1-1915s1c1
Sequence:CCGGGAACTCACTCTGGGCTGTAACCTCGAGGTTACAGCCCAGAGTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-2128s1c1
Sequence:CCGGCTTTCCTGTGTGTACTCTGTCCTCGAGGACAGAGTACACACAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182471.1-2206s1c1
Sequence:CCGGGAAACAGCCAGCAAGAGTTAGCTCGAGCTAACTCTTGCTGGCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1070s1c1
Sequence:CCGGGTTCGGAGGTTTGATGAAATCCTCGAGGATTTCATCAAACCTCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-766s1c1
Sequence:CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182471.1-1904s1c1
Sequence:CCGGCAACGCTTGTAGAACTCACTCCTCGAGGAGTGAGTTCTACAAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1736s1c1
Sequence:CCGGGCCCGAGGCTTCTTCAAGAAGCTCGAGCTTCTTGAAGAAGCCTCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1415s1c1
Sequence:CCGGCGCAAGCTGTTTGAAGAACTTCTCGAGAAGTTCTTCAAACAGCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1021s1c1
Sequence:CCGGGAAGGGAAAGAACATCAAGATCTCGAGATCTTGATGTTCTTTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-566s1c1
Sequence:CCGGGCTGTGGCTCTAGACACTAAACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182471.1-1493s1c1
Sequence:CCGGGAGGCTTCTTATAAGTGTTTACTCGAGTAAACACTTATAAGAAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_182471.1-1706s1c1
Sequence:CCGGCGGGTGAACTTTGCCATGAATCTCGAGATTCATGGCAAAGTTCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-566s21c1
Sequence:CCGGGCTGTGGCTCTAGACACTAAACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-1070s21c1
Sequence:CCGGGTTCGGAGGTTTGATGAAATCCTCGAGGATTTCATCAAACCTCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-1904s21c1
Sequence:CCGGCAACGCTTGTAGAACTCACTCCTCGAGGAGTGAGTTCTACAAGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182471.1-766s21c1
Sequence:CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011099
VALIDATED
PKM MISSION shRNA Bacterial Glycerol Stock
pyruvate kinase, muscle
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011099.2-304s1c1
Sequence:CCGGCCATGCAGAGACCATCAAGAACTCGAGTTCTTGATGGTCTCTGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011099.2-180s21c1
Sequence:CCGGCCCGCAACACTGGCATCATTTCTCGAGAAATGATGCCAGTGTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1508s21c1
Sequence:CCGGGATGTCGACCTTCGTGTAAACCTCGAGGTTTACACGAAGGTCGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-231s21c1
Sequence:CCGGAGATGCTGAAGGAGATGATTACTCGAGTAATCATCTCCTTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-767s21c1
Sequence:CCGGGACATGGTGTTTGCATCTTTCCTCGAGGAAAGATGCAAACACCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1861s21c1
Sequence:CCGGGACTGGAAACCCTGACTTTATCTCGAGATAAAGTCAGGGTTTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1403s21c1
Sequence:CCGGATCATTGCCGTGACTCGAAATCTCGAGATTTCGAGTCACGGCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011099
VALIDATED
PKM MISSION shRNA shRNA Plasmid DNA
pyruvate kinase, muscle
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011099.2-304s1c1
Sequence:CCGGCCATGCAGAGACCATCAAGAACTCGAGTTCTTGATGGTCTCTGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011099.2-180s21c1
Sequence:CCGGCCCGCAACACTGGCATCATTTCTCGAGAAATGATGCCAGTGTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1508s21c1
Sequence:CCGGGATGTCGACCTTCGTGTAAACCTCGAGGTTTACACGAAGGTCGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-231s21c1
Sequence:CCGGAGATGCTGAAGGAGATGATTACTCGAGTAATCATCTCCTTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-767s21c1
Sequence:CCGGGACATGGTGTTTGCATCTTTCCTCGAGGAAAGATGCAAACACCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1861s21c1
Sequence:CCGGGACTGGAAACCCTGACTTTATCTCGAGATAAAGTCAGGGTTTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1403s21c1
Sequence:CCGGATCATTGCCGTGACTCGAAATCTCGAGATTTCGAGTCACGGCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011099
VALIDATED
PKM MISSION shRNA Lentiviral Transduction Particles
pyruvate kinase, muscle
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011099.2-304s1c1
Sequence:CCGGCCATGCAGAGACCATCAAGAACTCGAGTTCTTGATGGTCTCTGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011099.2-180s21c1
Sequence:CCGGCCCGCAACACTGGCATCATTTCTCGAGAAATGATGCCAGTGTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1508s21c1
Sequence:CCGGGATGTCGACCTTCGTGTAAACCTCGAGGTTTACACGAAGGTCGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-231s21c1
Sequence:CCGGAGATGCTGAAGGAGATGATTACTCGAGTAATCATCTCCTTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-767s21c1
Sequence:CCGGGACATGGTGTTTGCATCTTTCCTCGAGGAAAGATGCAAACACCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1861s21c1
Sequence:CCGGGACTGGAAACCCTGACTTTATCTCGAGATAAAGTCAGGGTTTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011099.2-1403s21c1
Sequence:CCGGATCATTGCCGTGACTCGAAATCTCGAGATTTCGAGTCACGGCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)