EMAIL THIS PAGE TO A FRIEND

PKMYT1

protein kinase, membrane associated tyrosine/threonine 1

150 Gene Product Result for
Synonyms: MYT1
Gene ID:
Human(9088) Summary: This gene encodes a member of the serine/threonine protein kinase family. The encoded protein is a membrane-associated kinase that negatively regulates the G2/M transition of the cell cycle by phosphorylating and inactivating cyclin-dependent kinase 1. The activity of the encoded protein is regulated by polo-like kinase 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(268930) protein kinase, membrane associated tyrosine/threonine 1
Rat(287101) protein kinase, membrane associated tyrosine/threonine 1
Zebrafish(100049158) protein kinase, membrane associated tyrosine/threonine 1
dog(490050) protein kinase, membrane associated tyrosine/threonine 1
domestic cat(101098425) protein kinase, membrane associated tyrosine/threonine 1
Horse(100068871) protein kinase, membrane associated tyrosine/threonine 1
domestic guinea pig(100714526) protein kinase, membrane associated tyrosine/threonine 1
naked mole-rat(101721451) protein kinase, membrane associated tyrosine/threonine 1
cow(522613) protein kinase, membrane associated tyrosine/threonine 1
sheep(101119784) protein kinase, membrane associated tyrosine/threonine 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302023 ANTI-MOUSE PKMYT1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1300836 Anti-MYT1 (C-term) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4301306 Anti-phospho-MYT1 (pSer83) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1300077 Anti-Phospho-MYT1-T495 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA, immunohistochemistry, western blot pricing
K1392 Anti-PKMYT1 (476-489) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K1517 Anti-PKMYT1 (76-89) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300831 Anti-PKMYT1 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300820 Anti-PKMYT1 (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
HPA068860 Anti-PKMYT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4100319 Monoclonal Anti-PKMYT1 antibody produced in mouse clone PKMYT1-A270, culture supernatant human
western blot pricing
SAB1402446 Monoclonal Anti-PKMYT1, (C-terminal) antibody produced in mouse clone 2A3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004203 Rosetta Predictions human pricing
NM_182687 Rosetta Predictions human pricing
NM_001105766 Rosetta Predictions rat pricing
NM_023058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199784 predicted 739
2 SASI_Hs01_00199785 predicted 846
3 SASI_Hs01_00199786 predicted 841
4 SASI_Hs01_00199787 predicted 812
5 SASI_Hs01_00199788 predicted 747
6 SASI_Hs01_00199789 predicted 621
7 SASI_Hs01_00199790 predicted 544
8 SASI_Hs01_00199792 predicted 1329
9 SASI_Hs01_00199793 predicted 795
10 SASI_Hs02_00337100 predicted 1183
11 SASI_Hs01_00199791 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108043 predicted 745
2 SASI_Hs01_00108044 predicted 845
3 SASI_Hs01_00108045 predicted 837
4 SASI_Hs01_00108046 predicted 804
5 SASI_Hs01_00108047 predicted 746
6 SASI_Hs01_00108048 predicted 613
7 SASI_Hs01_00108049 predicted 544
8 SASI_Hs01_00108051 predicted 1328
9 SASI_Hs01_00108052 predicted 797
10 SASI_Hs02_00370853 predicted 1174
11 SASI_Hs01_00108050 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212316 predicted 429
2 SASI_Rn02_00212317 predicted 1136
3 SASI_Rn02_00212318 predicted 766
4 SASI_Rn02_00212319 predicted 678
5 SASI_Rn02_00212320 predicted 1001
6 SASI_Rn02_00212321 predicted 1417
7 SASI_Rn02_00212322 predicted 1198
8 SASI_Rn02_00212323 predicted 729
9 SASI_Rn02_00212324 predicted 1278
10 SASI_Rn02_00212325 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326759 predicted 714
2 SASI_Mm02_00326760 predicted 865
3 SASI_Mm02_00326761 predicted 1095
4 SASI_Mm02_00326762 predicted 757
5 SASI_Mm02_00326763 predicted 851
6 SASI_Mm02_00326764 predicted 1511
7 SASI_Mm02_00326765 predicted 590
8 SASI_Mm02_00326766 predicted 1149
9 SASI_Mm02_00326767 predicted 1159
10 SASI_Mm02_00326768 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004203
VALIDATED
PKMYT1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, membrane associated tyrosine/threonine 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1333s21c1
Sequence:CCGGTGGAAGTGGCATGCAACATGGCTCGAGCCATGTTGCATGCCACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-849s21c1
Sequence:CCGGTATGCGGTAAAGCGTTCCATGCTCGAGCATGGAACGCTTTACCGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1142s21c1
Sequence:CCGGTGTCAAGCCTGCCAACATCTTCTCGAGAAGATGTTGGCAGGCTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-800s21c1
Sequence:CCGGCTCCTACGGAGAGGTCTTCAACTCGAGTTGAAGACCTCTCCGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1411s21c1
Sequence:CCGGAGTTCACTGCCGGTCTGTCTTCTCGAGAAGACAGACCGGCAGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1438s21c1
Sequence:CCGGTGCGTTCTGTCCTTGTCATGACTCGAGTCATGACAAGGACAGAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-549s21c1
Sequence:CCGGGAACCTGGATTCTCCCTCAAGCTCGAGCTTGAGGGAGAATCCAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-541s1c1
Sequence:CCGGGCCACGCAGAACCTGGATTCTCTCGAGAGAATCCAGGTTCTGCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-848s1c1
Sequence:CCGGCTATGCGGTAAAGCGTTCCATCTCGAGATGGAACGCTTTACCGCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1947s1c1
Sequence:CCGGCCAGACTCTGCCTCTGCACTTCTCGAGAAGTGCAGAGGCAGAGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1436s1c1
Sequence:CCGGGCTGCGTTCTGTCCTTGTCATCTCGAGATGACAAGGACAGAACGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-1136s1c1
Sequence:CCGGCCTTGATGTCAAGCCTGCCAACTCGAGTTGGCAGGCTTGACATCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-813s1c1
Sequence:CCGGGTCTTCAAGGTGCGCTCCAAGCTCGAGCTTGGAGCGCACCTTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004203.3-1958s1c1
Sequence:CCGGCTCTGCACTTTTAACCTTTTACTCGAGTAAAAGGTTAAAAGTGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004203.3-1957s1c1
Sequence:CCGGCCTCTGCACTTTTAACCTTTTCTCGAGAAAAGGTTAAAAGTGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1408s1c1
Sequence:CCGGCTGAGTTCACTGCCGGTCTGTCTCGAGACAGACCGGCAGTGAACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1299s1c1
Sequence:CCGGGCAGCGGATGTGTTCAGTCTGCTCGAGCAGACTGAACACATCCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004203
VALIDATED
PKMYT1 MISSION shRNA shRNA Plasmid DNA
protein kinase, membrane associated tyrosine/threonine 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1333s21c1
Sequence:CCGGTGGAAGTGGCATGCAACATGGCTCGAGCCATGTTGCATGCCACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-849s21c1
Sequence:CCGGTATGCGGTAAAGCGTTCCATGCTCGAGCATGGAACGCTTTACCGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1142s21c1
Sequence:CCGGTGTCAAGCCTGCCAACATCTTCTCGAGAAGATGTTGGCAGGCTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-800s21c1
Sequence:CCGGCTCCTACGGAGAGGTCTTCAACTCGAGTTGAAGACCTCTCCGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1411s21c1
Sequence:CCGGAGTTCACTGCCGGTCTGTCTTCTCGAGAAGACAGACCGGCAGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1438s21c1
Sequence:CCGGTGCGTTCTGTCCTTGTCATGACTCGAGTCATGACAAGGACAGAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-549s21c1
Sequence:CCGGGAACCTGGATTCTCCCTCAAGCTCGAGCTTGAGGGAGAATCCAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-541s1c1
Sequence:CCGGGCCACGCAGAACCTGGATTCTCTCGAGAGAATCCAGGTTCTGCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-848s1c1
Sequence:CCGGCTATGCGGTAAAGCGTTCCATCTCGAGATGGAACGCTTTACCGCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1947s1c1
Sequence:CCGGCCAGACTCTGCCTCTGCACTTCTCGAGAAGTGCAGAGGCAGAGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1436s1c1
Sequence:CCGGGCTGCGTTCTGTCCTTGTCATCTCGAGATGACAAGGACAGAACGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-1136s1c1
Sequence:CCGGCCTTGATGTCAAGCCTGCCAACTCGAGTTGGCAGGCTTGACATCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-813s1c1
Sequence:CCGGGTCTTCAAGGTGCGCTCCAAGCTCGAGCTTGGAGCGCACCTTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004203.3-1958s1c1
Sequence:CCGGCTCTGCACTTTTAACCTTTTACTCGAGTAAAAGGTTAAAAGTGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004203.3-1957s1c1
Sequence:CCGGCCTCTGCACTTTTAACCTTTTCTCGAGAAAAGGTTAAAAGTGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1408s1c1
Sequence:CCGGCTGAGTTCACTGCCGGTCTGTCTCGAGACAGACCGGCAGTGAACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1299s1c1
Sequence:CCGGGCAGCGGATGTGTTCAGTCTGCTCGAGCAGACTGAACACATCCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004203
VALIDATED
PKMYT1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, membrane associated tyrosine/threonine 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1333s21c1
Sequence:CCGGTGGAAGTGGCATGCAACATGGCTCGAGCCATGTTGCATGCCACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-849s21c1
Sequence:CCGGTATGCGGTAAAGCGTTCCATGCTCGAGCATGGAACGCTTTACCGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1142s21c1
Sequence:CCGGTGTCAAGCCTGCCAACATCTTCTCGAGAAGATGTTGGCAGGCTTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-800s21c1
Sequence:CCGGCTCCTACGGAGAGGTCTTCAACTCGAGTTGAAGACCTCTCCGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1411s21c1
Sequence:CCGGAGTTCACTGCCGGTCTGTCTTCTCGAGAAGACAGACCGGCAGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-1438s21c1
Sequence:CCGGTGCGTTCTGTCCTTGTCATGACTCGAGTCATGACAAGGACAGAACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004203.3-549s21c1
Sequence:CCGGGAACCTGGATTCTCCCTCAAGCTCGAGCTTGAGGGAGAATCCAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-541s1c1
Sequence:CCGGGCCACGCAGAACCTGGATTCTCTCGAGAGAATCCAGGTTCTGCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-848s1c1
Sequence:CCGGCTATGCGGTAAAGCGTTCCATCTCGAGATGGAACGCTTTACCGCATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1947s1c1
Sequence:CCGGCCAGACTCTGCCTCTGCACTTCTCGAGAAGTGCAGAGGCAGAGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1436s1c1
Sequence:CCGGGCTGCGTTCTGTCCTTGTCATCTCGAGATGACAAGGACAGAACGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004203.3-1136s1c1
Sequence:CCGGCCTTGATGTCAAGCCTGCCAACTCGAGTTGGCAGGCTTGACATCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-813s1c1
Sequence:CCGGGTCTTCAAGGTGCGCTCCAAGCTCGAGCTTGGAGCGCACCTTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004203.3-1958s1c1
Sequence:CCGGCTCTGCACTTTTAACCTTTTACTCGAGTAAAAGGTTAAAAGTGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004203.3-1957s1c1
Sequence:CCGGCCTCTGCACTTTTAACCTTTTCTCGAGAAAAGGTTAAAAGTGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1408s1c1
Sequence:CCGGCTGAGTTCACTGCCGGTCTGTCTCGAGACAGACCGGCAGTGAACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004203.3-1299s1c1
Sequence:CCGGGCAGCGGATGTGTTCAGTCTGCTCGAGCAGACTGAACACATCCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023058
VALIDATED
PKMYT1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, membrane associated tyrosine/threonine 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-1508s21c1
Sequence:CCGGCTGGAATGTTCTGTGGTATATCTCGAGATATACCACAGAACATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-812s21c1
Sequence:CCGGTGGGCGACTCTATGCTGTTAACTCGAGTTAACAGCATAGAGTCGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-597s21c1
Sequence:CCGGATCCCTGTCAGCCGTCTATTCCTCGAGGAATAGACGGCTGACAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-858s21c1
Sequence:CCGGCCCAAAGACCGAACTCGTAAACTCGAGTTTACGAGTTCGGTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-1245s21c1
Sequence:CCGGGAACTGCTGCAGGGCTCTTATCTCGAGATAAGAGCCCTGCAGCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-1696s21c1
Sequence:CCGGTCTCCAGCAGCTGGGATAATGCTCGAGCATTATCCCAGCTGCTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-1073s21c1
Sequence:CCGGGGCTCTGGACCATCTACATAGCTCGAGCTATGTAGATGGTCCAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-754s1c1
Sequence:CCGGACTCGTAAACTGGCTGAGGTACTCGAGTACCTCAGCCAGTTTACGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-1402s1c1
Sequence:CCGGCTGTGGTATATGGCTGCAGAACTCGAGTTCTGCAGCCATATACCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-961s1c1
Sequence:CCGGCTGGACCATCTACATAGTCAACTCGAGTTGACTATGTAGATGGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-1184s1c1
Sequence:CCGGCCATCTTGGAAGTGGCCTGTACTCGAGTACAGGCCACTTCCAAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-606s1c1
Sequence:CCGGCGAGTCCTTCTTTCAGCAGAACTCGAGTTCTGCTGAAAGAAGGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023058
VALIDATED
PKMYT1 MISSION shRNA shRNA Plasmid DNA
protein kinase, membrane associated tyrosine/threonine 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-1508s21c1
Sequence:CCGGCTGGAATGTTCTGTGGTATATCTCGAGATATACCACAGAACATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-812s21c1
Sequence:CCGGTGGGCGACTCTATGCTGTTAACTCGAGTTAACAGCATAGAGTCGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-597s21c1
Sequence:CCGGATCCCTGTCAGCCGTCTATTCCTCGAGGAATAGACGGCTGACAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-858s21c1
Sequence:CCGGCCCAAAGACCGAACTCGTAAACTCGAGTTTACGAGTTCGGTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-1245s21c1
Sequence:CCGGGAACTGCTGCAGGGCTCTTATCTCGAGATAAGAGCCCTGCAGCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-1696s21c1
Sequence:CCGGTCTCCAGCAGCTGGGATAATGCTCGAGCATTATCCCAGCTGCTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-1073s21c1
Sequence:CCGGGGCTCTGGACCATCTACATAGCTCGAGCTATGTAGATGGTCCAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-754s1c1
Sequence:CCGGACTCGTAAACTGGCTGAGGTACTCGAGTACCTCAGCCAGTTTACGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-1402s1c1
Sequence:CCGGCTGTGGTATATGGCTGCAGAACTCGAGTTCTGCAGCCATATACCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-961s1c1
Sequence:CCGGCTGGACCATCTACATAGTCAACTCGAGTTGACTATGTAGATGGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-1184s1c1
Sequence:CCGGCCATCTTGGAAGTGGCCTGTACTCGAGTACAGGCCACTTCCAAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-606s1c1
Sequence:CCGGCGAGTCCTTCTTTCAGCAGAACTCGAGTTCTGCTGAAAGAAGGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023058
VALIDATED
PKMYT1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, membrane associated tyrosine/threonine 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-1508s21c1
Sequence:CCGGCTGGAATGTTCTGTGGTATATCTCGAGATATACCACAGAACATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-812s21c1
Sequence:CCGGTGGGCGACTCTATGCTGTTAACTCGAGTTAACAGCATAGAGTCGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-597s21c1
Sequence:CCGGATCCCTGTCAGCCGTCTATTCCTCGAGGAATAGACGGCTGACAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-858s21c1
Sequence:CCGGCCCAAAGACCGAACTCGTAAACTCGAGTTTACGAGTTCGGTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-1245s21c1
Sequence:CCGGGAACTGCTGCAGGGCTCTTATCTCGAGATAAGAGCCCTGCAGCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023058.3-1696s21c1
Sequence:CCGGTCTCCAGCAGCTGGGATAATGCTCGAGCATTATCCCAGCTGCTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023058.3-1073s21c1
Sequence:CCGGGGCTCTGGACCATCTACATAGCTCGAGCTATGTAGATGGTCCAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-754s1c1
Sequence:CCGGACTCGTAAACTGGCTGAGGTACTCGAGTACCTCAGCCAGTTTACGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-1402s1c1
Sequence:CCGGCTGTGGTATATGGCTGCAGAACTCGAGTTCTGCAGCCATATACCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-961s1c1
Sequence:CCGGCTGGACCATCTACATAGTCAACTCGAGTTGACTATGTAGATGGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-1184s1c1
Sequence:CCGGCCATCTTGGAAGTGGCCTGTACTCGAGTACAGGCCACTTCCAAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023058.1-606s1c1
Sequence:CCGGCGAGTCCTTCTTTCAGCAGAACTCGAGTTCTGCTGAAAGAAGGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)