EMAIL THIS PAGE TO A FRIEND

PKN1

protein kinase N1

171 Gene Product Result for
Synonyms: DBK PAK-1 PAK1 PKN PKN-ALPHA PRK1 PRKCL1
Gene ID:
Human(5585) Summary: The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(320795) protein kinase N1
Rat(29355) protein kinase N1
Zebrafish(322655) protein kinase N1
dog(484903) protein kinase N1
domestic cat(101097547) protein kinase N1
cow(509080) protein kinase N1
sheep(101118101) protein kinase N1
naked mole-rat(101712866) protein kinase N1
domestic guinea pig(100713234) protein kinase N1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002741 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124131 MISSION® esiRNA esiRNA human PKN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002741 Rosetta Predictions human pricing
NM_213560 Rosetta Predictions human pricing
NM_017175 Rosetta Predictions rat pricing
NM_177262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147472 predicted 1984
2 SASI_Hs01_00147473 predicted 2042
3 SASI_Hs01_00147475 predicted 668
4 SASI_Hs01_00147476 predicted 794
5 SASI_Hs02_00334346 predicted 1306
6 SASI_Hs01_00147477 predicted 2385
7 SASI_Hs01_00147478 predicted 1447
8 SASI_Hs01_00147479 predicted 1341
9 SASI_Hs01_00147480 predicted 1264
10 SASI_Hs01_00147481 predicted 2340
11 SASI_Hs01_00147474 predicted 2684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047951 predicted 1854
2 SASI_Hs01_00047952 predicted 1911
3 SASI_Hs01_00047954 predicted 532
4 SASI_Hs01_00047955 predicted 661
5 SASI_Hs02_00374256 predicted 1169
6 SASI_Hs01_00047956 predicted 2243
7 SASI_Hs01_00047957 predicted 1306
8 SASI_Hs01_00047958 predicted 1205
9 SASI_Hs01_00047959 predicted 1135
10 SASI_Hs01_00047960 predicted 2208
11 SASI_Hs01_00047953 predicted 2561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108974 predicted 819
2 SASI_Rn01_00108975 predicted 2056
3 SASI_Rn01_00108976 predicted 937
4 SASI_Rn01_00108977 predicted 2115
5 SASI_Rn01_00108978 predicted 1833
6 SASI_Rn01_00108979 predicted 1679
7 SASI_Rn01_00108980 predicted 2416
8 SASI_Rn01_00108982 predicted 1675
9 SASI_Rn02_00261505 predicted 2580
10 SASI_Rn02_00261506 predicted 652
11 SASI_Rn01_00108981 predicted 2547
12 SASI_Rn01_00108983 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028143 predicted 2066
2 SASI_Mm01_00028144 predicted 785
3 SASI_Mm01_00028145 predicted 420
4 SASI_Mm01_00028146 predicted 902
5 SASI_Mm01_00028147 predicted 2029
6 SASI_Mm01_00028148 predicted 2382
7 SASI_Mm01_00028149 predicted 2104
8 SASI_Mm01_00028150 predicted 573
9 SASI_Mm01_00028151 predicted 653
10 SASI_Mm01_00028152 predicted 1240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002741
VALIDATED
PKN1 MISSION shRNA Bacterial Glycerol Stock
protein kinase N1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-2203s1c1
Sequence:CCGGGTGAACCTCTTCGGCTGTTTCCTCGAGGAAACAGCCGAAGAGGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-1681s1c1
Sequence:CCGGGCTAGGCAGATGAACATCGATCTCGAGATCGATGTTCATCTGCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-307s1c1
Sequence:CCGGCGCAAGGAGCTGAAGCTGAAGCTCGAGCTTCAGCTTCAGCTCCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-2064s1c1
Sequence:CCGGGATGTGTGAGAAGCGGATATTCTCGAGAATATCCGCTTCTCACACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-521s1c1
Sequence:CCGGAGAACATGATCCAGACCTACACTCGAGTGTAGGTCTGGATCATGTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-525s1c1
Sequence:CCGGCATGATCCAGACCTACAGCAACTCGAGTTGCTGTAGGTCTGGATCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-1226s1c1
Sequence:CCGGTCAAAGCAGAAGCCGAGAACACTCGAGTGTTCTCGGCTTCTGCTTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-2062s1c1
Sequence:CCGGCTGATGTGTGAGAAGCGGATACTCGAGTATCCGCTTCTCACACATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-2385s1c1
Sequence:CCGGGGACCTGAAGTTGGACAATTTCTCGAGAAATTGTCCAACTTCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-1992s1c1
Sequence:CCGGACCTCTGACCCTCGAAGATTTCTCGAGAAATCTTCGAGGGTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002741
VALIDATED
PKN1 MISSION shRNA shRNA Plasmid DNA
protein kinase N1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-2203s1c1
Sequence:CCGGGTGAACCTCTTCGGCTGTTTCCTCGAGGAAACAGCCGAAGAGGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-1681s1c1
Sequence:CCGGGCTAGGCAGATGAACATCGATCTCGAGATCGATGTTCATCTGCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-307s1c1
Sequence:CCGGCGCAAGGAGCTGAAGCTGAAGCTCGAGCTTCAGCTTCAGCTCCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-2064s1c1
Sequence:CCGGGATGTGTGAGAAGCGGATATTCTCGAGAATATCCGCTTCTCACACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-521s1c1
Sequence:CCGGAGAACATGATCCAGACCTACACTCGAGTGTAGGTCTGGATCATGTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-525s1c1
Sequence:CCGGCATGATCCAGACCTACAGCAACTCGAGTTGCTGTAGGTCTGGATCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-1226s1c1
Sequence:CCGGTCAAAGCAGAAGCCGAGAACACTCGAGTGTTCTCGGCTTCTGCTTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-2062s1c1
Sequence:CCGGCTGATGTGTGAGAAGCGGATACTCGAGTATCCGCTTCTCACACATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-2385s1c1
Sequence:CCGGGGACCTGAAGTTGGACAATTTCTCGAGAAATTGTCCAACTTCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-1992s1c1
Sequence:CCGGACCTCTGACCCTCGAAGATTTCTCGAGAAATCTTCGAGGGTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002741
VALIDATED
PKN1 MISSION shRNA Lentiviral Transduction Particles
protein kinase N1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-2203s1c1
Sequence:CCGGGTGAACCTCTTCGGCTGTTTCCTCGAGGAAACAGCCGAAGAGGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-1681s1c1
Sequence:CCGGGCTAGGCAGATGAACATCGATCTCGAGATCGATGTTCATCTGCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-307s1c1
Sequence:CCGGCGCAAGGAGCTGAAGCTGAAGCTCGAGCTTCAGCTTCAGCTCCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-2064s1c1
Sequence:CCGGGATGTGTGAGAAGCGGATATTCTCGAGAATATCCGCTTCTCACACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-521s1c1
Sequence:CCGGAGAACATGATCCAGACCTACACTCGAGTGTAGGTCTGGATCATGTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-525s1c1
Sequence:CCGGCATGATCCAGACCTACAGCAACTCGAGTTGCTGTAGGTCTGGATCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-1226s1c1
Sequence:CCGGTCAAAGCAGAAGCCGAGAACACTCGAGTGTTCTCGGCTTCTGCTTTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002741.x-2062s1c1
Sequence:CCGGCTGATGTGTGAGAAGCGGATACTCGAGTATCCGCTTCTCACACATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-2385s1c1
Sequence:CCGGGGACCTGAAGTTGGACAATTTCTCGAGAAATTGTCCAACTTCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002741.3-1992s1c1
Sequence:CCGGACCTCTGACCCTCGAAGATTTCTCGAGAAATCTTCGAGGGTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177262
VALIDATED
PKN1 MISSION shRNA Bacterial Glycerol Stock
protein kinase N1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-2266s1c1
Sequence:CCGGGCACATTCATAGCGACGTGTTCTCGAGAACACGTCGCTATGAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177262.3-1661s1c1
Sequence:CCGGGCCAGACAGATGAACATAGATCTCGAGATCTATGTTCATCTGTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-2075s1c1
Sequence:CCGGGCCATCAAAGCCTTGAAGAAACTCGAGTTTCTTCAAGGCTTTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-649s1c1
Sequence:CCGGGCAGGACAGTAAGACCAAGATCTCGAGATCTTGGTCTTACTGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-2943s21c1
Sequence:CCGGCCTTCCGGGATTTCGACTTTGCTCGAGCAAAGTCGAAATCCCGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-1773s21c1
Sequence:CCGGTCCGGCACACTGGAGACATATCTCGAGATATGTCTCCAGTGTGCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-793s21c1
Sequence:CCGGTGAGGAGCTACGACACCATTTCTCGAGAAATGGTGTCGTAGCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-2818s21c1
Sequence:CCGGACCCTTCGTGCCTACACTTTCCTCGAGGAAAGTGTAGGCACGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177262
VALIDATED
PKN1 MISSION shRNA shRNA Plasmid DNA
protein kinase N1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-2266s1c1
Sequence:CCGGGCACATTCATAGCGACGTGTTCTCGAGAACACGTCGCTATGAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177262.3-1661s1c1
Sequence:CCGGGCCAGACAGATGAACATAGATCTCGAGATCTATGTTCATCTGTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-2075s1c1
Sequence:CCGGGCCATCAAAGCCTTGAAGAAACTCGAGTTTCTTCAAGGCTTTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-649s1c1
Sequence:CCGGGCAGGACAGTAAGACCAAGATCTCGAGATCTTGGTCTTACTGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-2943s21c1
Sequence:CCGGCCTTCCGGGATTTCGACTTTGCTCGAGCAAAGTCGAAATCCCGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-1773s21c1
Sequence:CCGGTCCGGCACACTGGAGACATATCTCGAGATATGTCTCCAGTGTGCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-793s21c1
Sequence:CCGGTGAGGAGCTACGACACCATTTCTCGAGAAATGGTGTCGTAGCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-2818s21c1
Sequence:CCGGACCCTTCGTGCCTACACTTTCCTCGAGGAAAGTGTAGGCACGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177262
VALIDATED
PKN1 MISSION shRNA Lentiviral Transduction Particles
protein kinase N1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-2266s1c1
Sequence:CCGGGCACATTCATAGCGACGTGTTCTCGAGAACACGTCGCTATGAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177262.3-1661s1c1
Sequence:CCGGGCCAGACAGATGAACATAGATCTCGAGATCTATGTTCATCTGTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-2075s1c1
Sequence:CCGGGCCATCAAAGCCTTGAAGAAACTCGAGTTTCTTCAAGGCTTTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177262.3-649s1c1
Sequence:CCGGGCAGGACAGTAAGACCAAGATCTCGAGATCTTGGTCTTACTGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-2943s21c1
Sequence:CCGGCCTTCCGGGATTTCGACTTTGCTCGAGCAAAGTCGAAATCCCGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-1773s21c1
Sequence:CCGGTCCGGCACACTGGAGACATATCTCGAGATATGTCTCCAGTGTGCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-793s21c1
Sequence:CCGGTGAGGAGCTACGACACCATTTCTCGAGAAATGGTGTCGTAGCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177262.3-2818s21c1
Sequence:CCGGACCCTTCGTGCCTACACTTTCCTCGAGGAAAGTGTAGGCACGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)