EMAIL THIS PAGE TO A FRIEND

PKN2

protein kinase N2

302 Gene Product Result for
Synonyms: PAK2 PRK2 PRKCL2 PRO2042 Pak-2
Gene ID:
Mouse(109333) protein kinase N2
Rat(207122) protein kinase N2
domestic guinea pig(100725077) protein kinase N2
naked mole-rat(101704633) protein kinase N2
Domestic Rabbit(100350018) protein kinase N2
cow(519754) protein kinase N2
sheep(101118744) protein kinase N2
Zebrafish(569086) protein kinase N2
Zebrafish(571965) protein kinase N2
chicken(424519) protein kinase N2
Horse(100052266) protein kinase N2
domestic cat(101081653) protein kinase N2
dog(490174) protein kinase N2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085541 MISSION® esiRNA esiRNA human PKN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006256 siRNAs that have been validated in the lab human pricing
NM_001105755 Rosetta Predictions rat pricing
NM_178654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006256 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017186 validated 3323
1 SASI_Hs01_00017185 validated 2243
1 SASI_Hs01_00017184 validated 936
2 SASI_Hs02_00341196 predicted 2979
3 SASI_Hs02_00341197 predicted 1503
4 SASI_Hs01_00017188 predicted 3282
5 SASI_Hs02_00341198 predicted 2247
6 SASI_Hs01_00017190 predicted 2833
7 SASI_Hs01_00017191 predicted 1313
8 SASI_Hs01_00017192 predicted 2130
9 SASI_Hs02_00341199 predicted 2707
10 SASI_Hs01_00017187 predicted 1005
11 SASI_Hs01_00017189 predicted 1981
12 SASI_Hs01_00017193 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212206 predicted 3281
2 SASI_Rn02_00212207 predicted 999
3 SASI_Rn02_00212208 predicted 715
4 SASI_Rn02_00212209 predicted 778
5 SASI_Rn02_00212210 predicted 1788
6 SASI_Rn02_00212211 predicted 2502
7 SASI_Rn02_00212212 predicted 662
8 SASI_Rn02_00212213 predicted 1916
9 SASI_Rn02_00212214 predicted 1061
10 SASI_Rn02_00212215 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157604 predicted 1046
2 SASI_Mm02_00349084 predicted 3375
3 SASI_Mm01_00157605 predicted 2753
4 SASI_Mm01_00157606 predicted 1772
5 SASI_Mm01_00157607 predicted 2516
6 SASI_Mm01_00157608 predicted 2423
7 SASI_Mm01_00157609 predicted 2613
8 SASI_Mm01_00157610 predicted 3256
9 SASI_Mm02_00349085 predicted 811
10 SASI_Mm01_00157611 predicted 2677
11 SASI_Mm01_00157612 predicted 2692
12 SASI_Mm01_00157613 predicted 1905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006256
VALIDATED
PKN2 MISSION shRNA Bacterial Glycerol Stock
protein kinase N2
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006256.2-3477s21c1
Sequence:CCGGATTGTACTTCAGCGTAAATATCTCGAGATATTTACGCTGAAGTACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-480s21c1
Sequence:CCGGTGATATCAAGGATCGAATTAACTCGAGTTAATTCGATCCTTGATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-3191s21c1
Sequence:CCGGTTACCTCAGAAGCACCTATTCCTCGAGGAATAGGTGCTTCTGAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-1329s1c1
Sequence:CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-1259s1c1
Sequence:CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-1329s21c1
Sequence:CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-1259s21c1
Sequence:CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006256.2-3918s21c1
Sequence:CCGGCAATCATGTAACAGGCTTATACTCGAGTATAAGCCTGTTACATGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-2236s21c1
Sequence:CCGGGGCCTAGAATATAGTGGTATTCTCGAGAATACCACTATATTCTAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006256.1-3041s1c1
Sequence:CCGGGCCACCAATAGCTTCTGAGTTCTCGAGAACTCAGAAGCTATTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006256.1-2800s1c1
Sequence:CCGGCCACCATTTATACCTACCATACTCGAGTATGGTAGGTATAAATGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006256.1-132s1c1
Sequence:CCGGGCAGCAGAAATTGGATGATATCTCGAGATATCATCCAATTTCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006256.1-2250s1c1
Sequence:CCGGGCACATTCATACTGATGTCTTCTCGAGAAGACATCAGTATGAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006256.1-309s1c1
Sequence:CCGGGCAGGAATTAAATGCACATATCTCGAGATATGTGCATTTAATTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-5351s1c1
Sequence:CCGGGCAGGGTCTATTTACACAATTCTCGAGAATTGTGTAAATAGACCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195219    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006256.2-4753s1c1
Sequence:CCGGCTTAGCATGTTAGGGTCATTACTCGAGTAATGACCCTAACATGCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-3918s1c1
Sequence:CCGGCAATCATGTAACAGGCTTATACTCGAGTATAAGCCTGTTACATGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006256
VALIDATED
PKN2 MISSION shRNA shRNA Plasmid DNA
protein kinase N2
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006256.2-3477s21c1
Sequence:CCGGATTGTACTTCAGCGTAAATATCTCGAGATATTTACGCTGAAGTACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-480s21c1
Sequence:CCGGTGATATCAAGGATCGAATTAACTCGAGTTAATTCGATCCTTGATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-3191s21c1
Sequence:CCGGTTACCTCAGAAGCACCTATTCCTCGAGGAATAGGTGCTTCTGAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-1329s1c1
Sequence:CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-1259s1c1
Sequence:CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-1329s21c1
Sequence:CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-1259s21c1
Sequence:CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006256.2-3918s21c1
Sequence:CCGGCAATCATGTAACAGGCTTATACTCGAGTATAAGCCTGTTACATGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-2236s21c1
Sequence:CCGGGGCCTAGAATATAGTGGTATTCTCGAGAATACCACTATATTCTAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006256.1-3041s1c1
Sequence:CCGGGCCACCAATAGCTTCTGAGTTCTCGAGAACTCAGAAGCTATTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006256.1-2800s1c1
Sequence:CCGGCCACCATTTATACCTACCATACTCGAGTATGGTAGGTATAAATGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006256.1-132s1c1
Sequence:CCGGGCAGCAGAAATTGGATGATATCTCGAGATATCATCCAATTTCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006256.1-2250s1c1
Sequence:CCGGGCACATTCATACTGATGTCTTCTCGAGAAGACATCAGTATGAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006256.1-309s1c1
Sequence:CCGGGCAGGAATTAAATGCACATATCTCGAGATATGTGCATTTAATTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-5351s1c1
Sequence:CCGGGCAGGGTCTATTTACACAATTCTCGAGAATTGTGTAAATAGACCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195219    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006256.2-4753s1c1
Sequence:CCGGCTTAGCATGTTAGGGTCATTACTCGAGTAATGACCCTAACATGCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-3918s1c1
Sequence:CCGGCAATCATGTAACAGGCTTATACTCGAGTATAAGCCTGTTACATGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006256
VALIDATED
PKN2 MISSION shRNA Lentiviral Transduction Particles
protein kinase N2
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006256.2-3477s21c1
Sequence:CCGGATTGTACTTCAGCGTAAATATCTCGAGATATTTACGCTGAAGTACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-480s21c1
Sequence:CCGGTGATATCAAGGATCGAATTAACTCGAGTTAATTCGATCCTTGATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-3191s21c1
Sequence:CCGGTTACCTCAGAAGCACCTATTCCTCGAGGAATAGGTGCTTCTGAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-1329s1c1
Sequence:CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-1259s1c1
Sequence:CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-1329s21c1
Sequence:CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-1259s21c1
Sequence:CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006256.2-3918s21c1
Sequence:CCGGCAATCATGTAACAGGCTTATACTCGAGTATAAGCCTGTTACATGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006256.2-2236s21c1
Sequence:CCGGGGCCTAGAATATAGTGGTATTCTCGAGAATACCACTATATTCTAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006256.1-3041s1c1
Sequence:CCGGGCCACCAATAGCTTCTGAGTTCTCGAGAACTCAGAAGCTATTGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006256.1-2800s1c1
Sequence:CCGGCCACCATTTATACCTACCATACTCGAGTATGGTAGGTATAAATGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006256.1-132s1c1
Sequence:CCGGGCAGCAGAAATTGGATGATATCTCGAGATATCATCCAATTTCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006256.1-2250s1c1
Sequence:CCGGGCACATTCATACTGATGTCTTCTCGAGAAGACATCAGTATGAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006256.1-309s1c1
Sequence:CCGGGCAGGAATTAAATGCACATATCTCGAGATATGTGCATTTAATTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-5351s1c1
Sequence:CCGGGCAGGGTCTATTTACACAATTCTCGAGAATTGTGTAAATAGACCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195219    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006256.2-4753s1c1
Sequence:CCGGCTTAGCATGTTAGGGTCATTACTCGAGTAATGACCCTAACATGCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006256.2-3918s1c1
Sequence:CCGGCAATCATGTAACAGGCTTATACTCGAGTATAAGCCTGTTACATGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178654
PKN2 MISSION shRNA Bacterial Glycerol Stock
protein kinase N2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-2624s21c1
Sequence:CCGGTGTAGTTCTTGGGTTGCAATACTCGAGTATTGCAACCCAAGAACTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-2339s21c1
Sequence:CCGGGGTGCTGTTGGCGGAATATAACTCGAGTTATATTCCGCCAACAGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-1265s21c1
Sequence:CCGGGTCCACGCAGAACCAGTATAGCTCGAGCTATACTGGTTCTGCGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-469s21c1
Sequence:CCGGACGACATCAAGGATCGAATAACTCGAGTTATTCGATCCTTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178654.2-3316s1c1
Sequence:CCGGCCAACAAGAAGACCTCTTGAACTCGAGTTCAAGAGGTCTTCTTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-3148s1c1
Sequence:CCGGCGGGAAGATGTTAGTAACTTTCTCGAGAAAGTTACTAACATCTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-870s1c1
Sequence:CCGGGCTACAGGATAGCAAGACAAACTCGAGTTTGTCTTGCTATCCTGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-1499s1c1
Sequence:CCGGCCAATGATGTTTGTGCTGTTTCTCGAGAAACAGCACAAACATCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178654
PKN2 MISSION shRNA shRNA Plasmid DNA
protein kinase N2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-2624s21c1
Sequence:CCGGTGTAGTTCTTGGGTTGCAATACTCGAGTATTGCAACCCAAGAACTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-2339s21c1
Sequence:CCGGGGTGCTGTTGGCGGAATATAACTCGAGTTATATTCCGCCAACAGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-1265s21c1
Sequence:CCGGGTCCACGCAGAACCAGTATAGCTCGAGCTATACTGGTTCTGCGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-469s21c1
Sequence:CCGGACGACATCAAGGATCGAATAACTCGAGTTATTCGATCCTTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178654.2-3316s1c1
Sequence:CCGGCCAACAAGAAGACCTCTTGAACTCGAGTTCAAGAGGTCTTCTTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-3148s1c1
Sequence:CCGGCGGGAAGATGTTAGTAACTTTCTCGAGAAAGTTACTAACATCTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-870s1c1
Sequence:CCGGGCTACAGGATAGCAAGACAAACTCGAGTTTGTCTTGCTATCCTGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-1499s1c1
Sequence:CCGGCCAATGATGTTTGTGCTGTTTCTCGAGAAACAGCACAAACATCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178654
PKN2 MISSION shRNA Lentiviral Transduction Particles
protein kinase N2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-2624s21c1
Sequence:CCGGTGTAGTTCTTGGGTTGCAATACTCGAGTATTGCAACCCAAGAACTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-2339s21c1
Sequence:CCGGGGTGCTGTTGGCGGAATATAACTCGAGTTATATTCCGCCAACAGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-1265s21c1
Sequence:CCGGGTCCACGCAGAACCAGTATAGCTCGAGCTATACTGGTTCTGCGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178654.3-469s21c1
Sequence:CCGGACGACATCAAGGATCGAATAACTCGAGTTATTCGATCCTTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178654.2-3316s1c1
Sequence:CCGGCCAACAAGAAGACCTCTTGAACTCGAGTTCAAGAGGTCTTCTTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-3148s1c1
Sequence:CCGGCGGGAAGATGTTAGTAACTTTCTCGAGAAAGTTACTAACATCTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-870s1c1
Sequence:CCGGGCTACAGGATAGCAAGACAAACTCGAGTTTGTCTTGCTATCCTGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178654.2-1499s1c1
Sequence:CCGGCCAATGATGTTTGTGCTGTTTCTCGAGAAACAGCACAAACATCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)