EMAIL THIS PAGE TO A FRIEND

PKN3

protein kinase N3

76 Gene Product Result for
Synonyms: RP11-545E17.1
UniProtKB ID: Q6P5Z2, Q9UM03
Gene ID:
Mouse(263803) protein kinase N3
Rat(296619) protein kinase N3
Zebrafish(323182) protein kinase N3
chicken(417209) protein kinase N3
dog(491313) protein kinase N3
Horse(100066882) protein kinase N3
domestic cat(101093557) protein kinase N3
cow(505353) protein kinase N3
sheep(101106926) protein kinase N3
naked mole-rat(101719018) protein kinase N3
domestic guinea pig(100714577) protein kinase N3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013355 Rosetta Predictions human pricing
NM_001047861 Rosetta Predictions rat pricing
XM_216019 Rosetta Predictions rat pricing
NM_153805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048290 predicted 979
2 SASI_Hs01_00048291 predicted 2376
3 SASI_Hs02_00344684 predicted 2368
4 SASI_Hs01_00048293 predicted 2289
5 SASI_Hs01_00048295 predicted 3094
6 SASI_Hs01_00048296 predicted 1867
7 SASI_Hs01_00048297 predicted 991
8 SASI_Hs01_00048298 predicted 1196
9 SASI_Hs01_00048299 predicted 2822
10 SASI_Hs02_00344685 predicted 2128
11 SASI_Hs01_00048292 predicted 3026
12 SASI_Hs01_00048294 predicted 1870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206285 predicted 2314
2 SASI_Rn02_00206286 predicted 1455
3 SASI_Rn02_00206287 predicted 1352
4 SASI_Rn02_00206288 predicted 247
5 SASI_Rn02_00206289 predicted 248
6 SASI_Rn02_00206290 predicted 252
7 SASI_Rn02_00206291 predicted 2470
8 SASI_Rn02_00206292 predicted 2555
9 SASI_Rn02_00206293 predicted 467
10 SASI_Rn02_00206294 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163217 predicted 2305
2 SASI_Rn01_00163218 predicted 2263
3 SASI_Rn01_00163219 predicted 2259
4 SASI_Rn01_00163220 predicted 2292
5 SASI_Rn01_00163221 predicted 2295
6 SASI_Rn01_00163222 predicted 2387
7 SASI_Rn01_00163223 predicted 2282
8 SASI_Rn01_00163224 predicted 2288
9 SASI_Rn01_00163225 predicted 2409
10 SASI_Rn01_00163226 predicted 2344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028751 predicted 2030
2 SASI_Mm01_00028752 predicted 2706
3 SASI_Mm01_00028753 predicted 800
4 SASI_Mm01_00028754 predicted 1920
5 SASI_Mm01_00028755 predicted 572
6 SASI_Mm01_00028756 predicted 1121
7 SASI_Mm01_00028757 predicted 1033
8 SASI_Mm01_00028758 predicted 1036
9 SASI_Mm01_00028759 predicted 2078
10 SASI_Mm01_00028760 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013355
VALIDATED
PKN3 MISSION shRNA Bacterial Glycerol Stock
protein kinase N3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-2025s1c1
Sequence:CCGGACACGAGAAGAAGATCATTTACTCGAGTAAATGATCTTCTTCTCGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-3095s21c1
Sequence:CCGGCCACAGACTGTTAGAGCCTCTCTCGAGAGAGGCTCTAACAGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-1740s1c1
Sequence:CCGGGACAGGGAAATACTACGCCATCTCGAGATGGCGTAGTATTTCCCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-343s1c1
Sequence:CCGGCATGTGGAGCTGAAGGTGAAACTCGAGTTTCACCTTCAGCTCCACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-1240s1c1
Sequence:CCGGACCTTCTGCGATCCTGTCATTCTCGAGAATGACAGGATCGCAGAAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-2745s21c1
Sequence:CCGGGCAAGGGCTTGAGTTCATTCACTCGAGTGAATGAACTCAAGCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013355.3-1633s21c1
Sequence:CCGGACCTTCTGCGATCCTGTCATTCTCGAGAATGACAGGATCGCAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-2745s1c1
Sequence:CCGGGCAAGGGCTTGAGTTCATTCACTCGAGTGAATGAACTCAAGCCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-2296s1c1
Sequence:CCGGGCCTGCTTTGTGACTGAGTTTCTCGAGAAACTCAGTCACAAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-2694s1c1
Sequence:CCGGGTTTGACTGCATCGTCAACATCTCGAGATGTTGACGATGCAGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013355.3-3148s1c1
Sequence:CCGGCAGGCCTTGCTGGGTACTTCTCTCGAGAGAAGTACCCAGCAAGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-2917s1c1
Sequence:CCGGCCTGCGGACCTGCGCTACTTTCTCGAGAAAGTAGCGCAGGTCCGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-3095s1c1
Sequence:CCGGCCACAGACTGTTAGAGCCTCTCTCGAGAGAGGCTCTAACAGTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-763s1c1
Sequence:CCGGGCTGAGAACATGACCCACACGCTCGAGCGTGTGGGTCATGTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013355.3-2418s21c1
Sequence:CCGGACACGAGAAGAAGATCATTTACTCGAGTAAATGATCTTCTTCTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-2296s21c1
Sequence:CCGGGCCTGCTTTGTGACTGAGTTTCTCGAGAAACTCAGTCACAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013355
VALIDATED
PKN3 MISSION shRNA shRNA Plasmid DNA
protein kinase N3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-2025s1c1
Sequence:CCGGACACGAGAAGAAGATCATTTACTCGAGTAAATGATCTTCTTCTCGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-3095s21c1
Sequence:CCGGCCACAGACTGTTAGAGCCTCTCTCGAGAGAGGCTCTAACAGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-1740s1c1
Sequence:CCGGGACAGGGAAATACTACGCCATCTCGAGATGGCGTAGTATTTCCCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-343s1c1
Sequence:CCGGCATGTGGAGCTGAAGGTGAAACTCGAGTTTCACCTTCAGCTCCACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-1240s1c1
Sequence:CCGGACCTTCTGCGATCCTGTCATTCTCGAGAATGACAGGATCGCAGAAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-2745s21c1
Sequence:CCGGGCAAGGGCTTGAGTTCATTCACTCGAGTGAATGAACTCAAGCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013355.3-1633s21c1
Sequence:CCGGACCTTCTGCGATCCTGTCATTCTCGAGAATGACAGGATCGCAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-2745s1c1
Sequence:CCGGGCAAGGGCTTGAGTTCATTCACTCGAGTGAATGAACTCAAGCCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-2296s1c1
Sequence:CCGGGCCTGCTTTGTGACTGAGTTTCTCGAGAAACTCAGTCACAAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-2694s1c1
Sequence:CCGGGTTTGACTGCATCGTCAACATCTCGAGATGTTGACGATGCAGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013355.3-3148s1c1
Sequence:CCGGCAGGCCTTGCTGGGTACTTCTCTCGAGAGAAGTACCCAGCAAGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-2917s1c1
Sequence:CCGGCCTGCGGACCTGCGCTACTTTCTCGAGAAAGTAGCGCAGGTCCGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-3095s1c1
Sequence:CCGGCCACAGACTGTTAGAGCCTCTCTCGAGAGAGGCTCTAACAGTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-763s1c1
Sequence:CCGGGCTGAGAACATGACCCACACGCTCGAGCGTGTGGGTCATGTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013355.3-2418s21c1
Sequence:CCGGACACGAGAAGAAGATCATTTACTCGAGTAAATGATCTTCTTCTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-2296s21c1
Sequence:CCGGGCCTGCTTTGTGACTGAGTTTCTCGAGAAACTCAGTCACAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013355
VALIDATED
PKN3 MISSION shRNA Lentiviral Transduction Particles
protein kinase N3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-2025s1c1
Sequence:CCGGACACGAGAAGAAGATCATTTACTCGAGTAAATGATCTTCTTCTCGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-3095s21c1
Sequence:CCGGCCACAGACTGTTAGAGCCTCTCTCGAGAGAGGCTCTAACAGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-1740s1c1
Sequence:CCGGGACAGGGAAATACTACGCCATCTCGAGATGGCGTAGTATTTCCCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-343s1c1
Sequence:CCGGCATGTGGAGCTGAAGGTGAAACTCGAGTTTCACCTTCAGCTCCACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.x-1240s1c1
Sequence:CCGGACCTTCTGCGATCCTGTCATTCTCGAGAATGACAGGATCGCAGAAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-2745s21c1
Sequence:CCGGGCAAGGGCTTGAGTTCATTCACTCGAGTGAATGAACTCAAGCCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013355.3-1633s21c1
Sequence:CCGGACCTTCTGCGATCCTGTCATTCTCGAGAATGACAGGATCGCAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-2745s1c1
Sequence:CCGGGCAAGGGCTTGAGTTCATTCACTCGAGTGAATGAACTCAAGCCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-2296s1c1
Sequence:CCGGGCCTGCTTTGTGACTGAGTTTCTCGAGAAACTCAGTCACAAAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-2694s1c1
Sequence:CCGGGTTTGACTGCATCGTCAACATCTCGAGATGTTGACGATGCAGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013355.3-3148s1c1
Sequence:CCGGCAGGCCTTGCTGGGTACTTCTCTCGAGAGAAGTACCCAGCAAGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-2917s1c1
Sequence:CCGGCCTGCGGACCTGCGCTACTTTCTCGAGAAAGTAGCGCAGGTCCGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013355.3-3095s1c1
Sequence:CCGGCCACAGACTGTTAGAGCCTCTCTCGAGAGAGGCTCTAACAGTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013355.3-763s1c1
Sequence:CCGGGCTGAGAACATGACCCACACGCTCGAGCGTGTGGGTCATGTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013355.3-2418s21c1
Sequence:CCGGACACGAGAAGAAGATCATTTACTCGAGTAAATGATCTTCTTCTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_013355.3-2296s21c1
Sequence:CCGGGCCTGCTTTGTGACTGAGTTTCTCGAGAAACTCAGTCACAAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153805
VALIDATED
PKN3 MISSION shRNA Bacterial Glycerol Stock
protein kinase N3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-1234s21c1
Sequence:CCGGCTGCGAGCCTGTCATTGAAAGCTCGAGCTTTCAATGACAGGCTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153805.1-2261s1c1
Sequence:CCGGGACACAGAAGAGGAGGTATTTCTCGAGAAATACCTCCTCTTCTGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153805.1-1613s1c1
Sequence:CCGGGCAGCCTTATCCACAAGGAAACTCGAGTTTCCTTGTGGATAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-304s21c1
Sequence:CCGGGCTCTCGGAGGCTTTACATAGCTCGAGCTATGTAAAGCCTCCGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-795s21c1
Sequence:CCGGGGACACTTGTGAAACCTATTGCTCGAGCAATAGGTTTCACAAGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-1643s21c1
Sequence:CCGGCTTCAAGACTTCCGATGTTTGCTCGAGCAAACATCGGAAGTCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-2001s21c1
Sequence:CCGGTACACGAGAAGAGGATCATTTCTCGAGAAATGATCCTCTTCTCGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153805
VALIDATED
PKN3 MISSION shRNA shRNA Plasmid DNA
protein kinase N3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-1234s21c1
Sequence:CCGGCTGCGAGCCTGTCATTGAAAGCTCGAGCTTTCAATGACAGGCTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153805.1-2261s1c1
Sequence:CCGGGACACAGAAGAGGAGGTATTTCTCGAGAAATACCTCCTCTTCTGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153805.1-1613s1c1
Sequence:CCGGGCAGCCTTATCCACAAGGAAACTCGAGTTTCCTTGTGGATAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-304s21c1
Sequence:CCGGGCTCTCGGAGGCTTTACATAGCTCGAGCTATGTAAAGCCTCCGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-795s21c1
Sequence:CCGGGGACACTTGTGAAACCTATTGCTCGAGCAATAGGTTTCACAAGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-1643s21c1
Sequence:CCGGCTTCAAGACTTCCGATGTTTGCTCGAGCAAACATCGGAAGTCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-2001s21c1
Sequence:CCGGTACACGAGAAGAGGATCATTTCTCGAGAAATGATCCTCTTCTCGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153805
VALIDATED
PKN3 MISSION shRNA Lentiviral Transduction Particles
protein kinase N3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-1234s21c1
Sequence:CCGGCTGCGAGCCTGTCATTGAAAGCTCGAGCTTTCAATGACAGGCTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153805.1-2261s1c1
Sequence:CCGGGACACAGAAGAGGAGGTATTTCTCGAGAAATACCTCCTCTTCTGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153805.1-1613s1c1
Sequence:CCGGGCAGCCTTATCCACAAGGAAACTCGAGTTTCCTTGTGGATAAGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-304s21c1
Sequence:CCGGGCTCTCGGAGGCTTTACATAGCTCGAGCTATGTAAAGCCTCCGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-795s21c1
Sequence:CCGGGGACACTTGTGAAACCTATTGCTCGAGCAATAGGTTTCACAAGTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-1643s21c1
Sequence:CCGGCTTCAAGACTTCCGATGTTTGCTCGAGCAAACATCGGAAGTCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153805.1-2001s21c1
Sequence:CCGGTACACGAGAAGAGGATCATTTCTCGAGAAATGATCCTCTTCTCGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)