EMAIL THIS PAGE TO A FRIEND

PKNOX1

PBX/knotted 1 homeobox 1

148 Gene Product Result for
Synonyms: PREP1 pkonx1c
UniProtKB ID: P55347, O00528, Q8IWT7
Gene ID:
Mouse(18771) Pbx/knotted 1 homeobox
Rat(294322) PBX/knotted 1 homeobox 1
cow(533382) PBX/knotted 1 homeobox 1
sheep(101106050) PBX/knotted 1 homeobox 1
domestic guinea pig(100723238) PBX/knotted 1 homeobox 1
naked mole-rat(101705108) PBX/knotted 1 homeobox 1
chicken(418542) PBX/knotted 1 homeobox 1
dog(611059) PBX/knotted 1 homeobox 1
domestic cat(101084563) PBX/knotted 1 homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004571 Rosetta Predictions human pricing
NM_197976 Rosetta Predictions human pricing
NM_001013074 Rosetta Predictions rat pricing
NM_016670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213040 predicted 951
2 SASI_Hs02_00337902 predicted 858
3 SASI_Hs02_00337903 predicted 948
4 SASI_Hs02_00337904 predicted 1134
5 SASI_Hs02_00337905 predicted 236
6 SASI_Hs01_00213045 predicted 563
7 SASI_Hs01_00213046 predicted 701
8 SASI_Hs02_00337906 predicted 1146
9 SASI_Hs02_00337907 predicted 381
10 SASI_Hs02_00337908 predicted 615
11 SASI_Hs01_00213037 predicted 625
12 SASI_Hs01_00213038 predicted 353
13 SASI_Hs01_00213039 predicted 651
14 SASI_Hs01_00213041 predicted 1073
15 SASI_Hs01_00213042 predicted 216
16 SASI_Hs01_00213043 predicted 939
17 SASI_Hs01_00213044 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024350 predicted 617
2 SASI_Hs01_00024351 predicted 359
3 SASI_Hs01_00024352 predicted 658
4 SASI_Hs01_00024353 predicted 955
5 SASI_Hs01_00024354 predicted 1065
6 SASI_Hs01_00024355 predicted 221
7 SASI_Hs01_00024356 predicted 943
8 SASI_Hs01_00024357 predicted 247
9 SASI_Hs01_00024358 predicted 569
10 SASI_Hs01_00024359 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107907 predicted 238
2 SASI_Rn01_00107908 predicted 430
3 SASI_Rn01_00107909 predicted 941
4 SASI_Rn01_00107910 predicted 1072
5 SASI_Rn01_00107911 predicted 408
6 SASI_Rn01_00107912 predicted 745
7 SASI_Rn01_00107913 predicted 442
8 SASI_Rn01_00107914 predicted 585
9 SASI_Rn01_00107915 predicted 501
10 SASI_Rn01_00107916 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113295 predicted 949
2 SASI_Mm01_00113296 predicted 1072
3 SASI_Mm01_00113297 predicted 439
4 SASI_Mm01_00113298 predicted 407
5 SASI_Mm01_00113299 predicted 1252
6 SASI_Mm01_00113300 predicted 1005
7 SASI_Mm01_00113301 predicted 460
8 SASI_Mm01_00113302 predicted 651
9 SASI_Mm01_00113303 predicted 961
10 SASI_Mm01_00113304 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016670
VALIDATED
PKNOX1 MISSION shRNA Bacterial Glycerol Stock
PBX/knotted 1 homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-842s21c1
Sequence:CCGGAGTGGTCACGCAGGCATTATCCTCGAGGATAATGCCTGCGTGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-562s21c1
Sequence:CCGGTTGAACTGGAGAAGGTTAATGCTCGAGCATTAACCTTCTCCAGTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-506s21c1
Sequence:CCGGTCCGGAAACTGACAACCTAATCTCGAGATTAGGTTGTCAGTTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-757s21c1
Sequence:CCGGCCCTACAACAGGGAAATGTAACTCGAGTTACATTTCCCTGTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016670.3-1702s21c1
Sequence:CCGGTTGAGTCCTTGACGAGATTAACTCGAGTTAATCTCGTCAAGGACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-100s1c1
Sequence:CCGGGCTATCAAGATGGACAGCAAACTCGAGTTTGCTGTCCATCTTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-652s1c1
Sequence:CCGGCCCTACAACAGGGAAATGTAACTCGAGTTACATTTCCCTGTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016670.2-348s1c1
Sequence:CCGGGAGAACTTTGTCAGGAAGCAACTCGAGTTGCTTCCTGACAAAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016670.2-977s1c1
Sequence:CCGGGCTTCAAGTCAACAACTGGTTCTCGAGAACCAGTTGTTGACTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-237s1c1
Sequence:CCGGGCCATTTATAGGCATCCACTACTCGAGTAGTGGATGCCTATAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016670
VALIDATED
PKNOX1 MISSION shRNA shRNA Plasmid DNA
PBX/knotted 1 homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-842s21c1
Sequence:CCGGAGTGGTCACGCAGGCATTATCCTCGAGGATAATGCCTGCGTGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-562s21c1
Sequence:CCGGTTGAACTGGAGAAGGTTAATGCTCGAGCATTAACCTTCTCCAGTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-506s21c1
Sequence:CCGGTCCGGAAACTGACAACCTAATCTCGAGATTAGGTTGTCAGTTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-757s21c1
Sequence:CCGGCCCTACAACAGGGAAATGTAACTCGAGTTACATTTCCCTGTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016670.3-1702s21c1
Sequence:CCGGTTGAGTCCTTGACGAGATTAACTCGAGTTAATCTCGTCAAGGACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-100s1c1
Sequence:CCGGGCTATCAAGATGGACAGCAAACTCGAGTTTGCTGTCCATCTTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-652s1c1
Sequence:CCGGCCCTACAACAGGGAAATGTAACTCGAGTTACATTTCCCTGTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016670.2-348s1c1
Sequence:CCGGGAGAACTTTGTCAGGAAGCAACTCGAGTTGCTTCCTGACAAAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016670.2-977s1c1
Sequence:CCGGGCTTCAAGTCAACAACTGGTTCTCGAGAACCAGTTGTTGACTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-237s1c1
Sequence:CCGGGCCATTTATAGGCATCCACTACTCGAGTAGTGGATGCCTATAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016670
VALIDATED
PKNOX1 MISSION shRNA Lentiviral Transduction Particles
PBX/knotted 1 homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-842s21c1
Sequence:CCGGAGTGGTCACGCAGGCATTATCCTCGAGGATAATGCCTGCGTGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-562s21c1
Sequence:CCGGTTGAACTGGAGAAGGTTAATGCTCGAGCATTAACCTTCTCCAGTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-506s21c1
Sequence:CCGGTCCGGAAACTGACAACCTAATCTCGAGATTAGGTTGTCAGTTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016670.3-757s21c1
Sequence:CCGGCCCTACAACAGGGAAATGTAACTCGAGTTACATTTCCCTGTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016670.3-1702s21c1
Sequence:CCGGTTGAGTCCTTGACGAGATTAACTCGAGTTAATCTCGTCAAGGACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-100s1c1
Sequence:CCGGGCTATCAAGATGGACAGCAAACTCGAGTTTGCTGTCCATCTTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-652s1c1
Sequence:CCGGCCCTACAACAGGGAAATGTAACTCGAGTTACATTTCCCTGTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016670.2-348s1c1
Sequence:CCGGGAGAACTTTGTCAGGAAGCAACTCGAGTTGCTTCCTGACAAAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016670.2-977s1c1
Sequence:CCGGGCTTCAAGTCAACAACTGGTTCTCGAGAACCAGTTGTTGACTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016670.2-237s1c1
Sequence:CCGGGCCATTTATAGGCATCCACTACTCGAGTAGTGGATGCCTATAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004571
VALIDATED
PKNOX1 MISSION shRNA Bacterial Glycerol Stock
PBX/knotted 1 homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-1070s21c1
Sequence:GTACCGGGATTGCTGCTCAGACAAATTTCTCGAGAAATTTGTCTGAGCAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004571.3-2122s21c1
Sequence:CCGGGAATTGGATGATGACTATATTCTCGAGAATATAGTCATCATCCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-593s21c1
Sequence:CCGGTAACGAACTCTGCAAAGATTTCTCGAGAAATCTTTGCAGAGTTCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-518s21c1
Sequence:CCGGAGATCCAGAAACTGATAATTTCTCGAGAAATTATCAGTTTCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-361s21c1
Sequence:CCGGTTTATAGGCATCCACTATTTCCTCGAGGAAATAGTGGATGCCTATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004571.3-2469s1c1
Sequence:CCGGCCGTACATACTCCAGTCTAATCTCGAGATTAGACTGGAGTATGTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-854s1c1
Sequence:CCGGCCAAGTGGTCACACAGACATTCTCGAGAATGTCTGTGTGACCACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-358s1c1
Sequence:CCGGCCATTTATAGGCATCCACTATCTCGAGATAGTGGATGCCTATAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004571.3-242s1c1
Sequence:CCGGGCAAGTAGTAACAGAGTTAAACTCGAGTTTAACTCTGTTACTACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-1077s1c1
Sequence:CCGGGCTCAGACAAATTTGACACTACTCGAGTAGTGTCAAATTTGTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004571
VALIDATED
PKNOX1 MISSION shRNA shRNA Plasmid DNA
PBX/knotted 1 homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-1070s21c1
Sequence:GTACCGGGATTGCTGCTCAGACAAATTTCTCGAGAAATTTGTCTGAGCAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004571.3-2122s21c1
Sequence:CCGGGAATTGGATGATGACTATATTCTCGAGAATATAGTCATCATCCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-593s21c1
Sequence:CCGGTAACGAACTCTGCAAAGATTTCTCGAGAAATCTTTGCAGAGTTCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-518s21c1
Sequence:CCGGAGATCCAGAAACTGATAATTTCTCGAGAAATTATCAGTTTCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-361s21c1
Sequence:CCGGTTTATAGGCATCCACTATTTCCTCGAGGAAATAGTGGATGCCTATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004571.3-2469s1c1
Sequence:CCGGCCGTACATACTCCAGTCTAATCTCGAGATTAGACTGGAGTATGTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-854s1c1
Sequence:CCGGCCAAGTGGTCACACAGACATTCTCGAGAATGTCTGTGTGACCACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-358s1c1
Sequence:CCGGCCATTTATAGGCATCCACTATCTCGAGATAGTGGATGCCTATAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004571.3-242s1c1
Sequence:CCGGGCAAGTAGTAACAGAGTTAAACTCGAGTTTAACTCTGTTACTACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-1077s1c1
Sequence:CCGGGCTCAGACAAATTTGACACTACTCGAGTAGTGTCAAATTTGTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004571
VALIDATED
PKNOX1 MISSION shRNA Lentiviral Transduction Particles
PBX/knotted 1 homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-1070s21c1
Sequence:GTACCGGGATTGCTGCTCAGACAAATTTCTCGAGAAATTTGTCTGAGCAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004571.3-2122s21c1
Sequence:CCGGGAATTGGATGATGACTATATTCTCGAGAATATAGTCATCATCCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-593s21c1
Sequence:CCGGTAACGAACTCTGCAAAGATTTCTCGAGAAATCTTTGCAGAGTTCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-518s21c1
Sequence:CCGGAGATCCAGAAACTGATAATTTCTCGAGAAATTATCAGTTTCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004571.3-361s21c1
Sequence:CCGGTTTATAGGCATCCACTATTTCCTCGAGGAAATAGTGGATGCCTATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004571.3-2469s1c1
Sequence:CCGGCCGTACATACTCCAGTCTAATCTCGAGATTAGACTGGAGTATGTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-854s1c1
Sequence:CCGGCCAAGTGGTCACACAGACATTCTCGAGAATGTCTGTGTGACCACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-358s1c1
Sequence:CCGGCCATTTATAGGCATCCACTATCTCGAGATAGTGGATGCCTATAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004571.3-242s1c1
Sequence:CCGGGCAAGTAGTAACAGAGTTAAACTCGAGTTTAACTCTGTTACTACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004571.3-1077s1c1
Sequence:CCGGGCTCAGACAAATTTGACACTACTCGAGTAGTGTCAAATTTGTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)