EMAIL THIS PAGE TO A FRIEND

PKNOX2

PBX/knotted 1 homeobox 2

195 Gene Product Result for
Synonyms: PREP2
UniProtKB ID: Q96KN3, Q63HL6, Q86XD1
Gene ID:
Human(63876) Summary: Homeodomain proteins are sequence-specific transcription factors that share a highly conserved DNA-binding domain and play fundamental roles in cell proliferation, differentiation, and death. PKNOX2 belongs to the TALE (3-amino acid loop extension) class of homeodomain proteins characterized by a 3-amino acid extension between alpha helices 1 and 2 within the homeodomain (Imoto et al., 2001 [PubMed 11549286]
Mouse(208076) Pbx/knotted 1 homeobox 2
Rat(680549) PBX/knotted 1 homeobox 2
Zebrafish(386959) pbx/knotted 1 homeobox 2
Horse(100072309) PBX/knotted 1 homeobox 2
domestic cat(101082006) PBX/knotted 1 homeobox 2
dog(479399) PBX/knotted 1 homeobox 2
chicken(374067) PBX/knotted 1 homeobox 2
naked mole-rat(101697647) PBX/knotted 1 homeobox 2
Domestic Rabbit(100357111) PBX/knotted 1 homeobox 2
domestic guinea pig(100721345) PBX/knotted 1 homeobox 2
cow(617454) PBX/knotted 1 homeobox 2
sheep(101110008) PBX/knotted 1 homeobox 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022062 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049081 MISSION® esiRNA esiRNA human PKNOX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022062 Rosetta Predictions human pricing
NM_001029838 Rosetta Predictions mouse pricing
NM_148950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355423 predicted 1125
2 SASI_Hs02_00355424 predicted 516
3 SASI_Hs01_00017104 predicted 992
4 SASI_Hs01_00017105 predicted 1116
5 SASI_Hs02_00355425 predicted 617
6 SASI_Hs02_00355426 predicted 2013
7 SASI_Hs01_00017106 predicted 1198
8 SASI_Hs02_00355427 predicted 2094
9 SASI_Hs02_00355428 predicted 722
10 SASI_Hs01_00017109 predicted 1034
11 SASI_Hs01_00017107 predicted 780
12 SASI_Hs01_00017108 predicted 396
13 SASI_Hs01_00017110 predicted 673
14 SASI_Hs01_00017111 predicted 557
15 SASI_Hs01_00017112 predicted 285
16 SASI_Hs01_00017113 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106638 predicted 1026
2 SASI_Mm02_00288014 predicted 1881
3 SASI_Mm01_00106639 predicted 529
4 SASI_Mm01_00106640 predicted 421
5 SASI_Mm01_00106642 predicted 789
6 SASI_Mm01_00106643 predicted 902
7 SASI_Mm02_00288015 predicted 589
8 SASI_Mm01_00106644 predicted 1904
9 SASI_Mm01_00106645 predicted 432
10 SASI_Mm01_00106647 predicted 470
11 SASI_Mm01_00106641 predicted 1117
12 SASI_Mm01_00106646 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050891 predicted 972
2 SASI_Mm02_00342774 predicted 1817
3 SASI_Mm01_00050892 predicted 475
4 SASI_Mm01_00050893 predicted 367
5 SASI_Mm01_00050895 predicted 724
6 SASI_Mm01_00050896 predicted 846
7 SASI_Mm02_00342775 predicted 531
8 SASI_Mm01_00050897 predicted 1852
9 SASI_Mm01_00050898 predicted 375
10 SASI_Mm01_00050900 predicted 416
11 SASI_Mm01_00050894 predicted 1050
12 SASI_Mm01_00050899 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148950
PKNOX2 MISSION shRNA Bacterial Glycerol Stock
PBX/knotted 1 homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1350s1c1
Sequence:CCGGGCACATGATGATTCATTGGATCTCGAGATCCAATGAATCATCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-775s1c1
Sequence:CCGGCCGTCAATTCTCAAGTCGTGTCTCGAGACACGACTTGAGAATTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1067s1c1
Sequence:CCGGCCTCACCCTTCTGCAAGTAAACTCGAGTTTACTTGCAGAAGGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-431s1c1
Sequence:CCGGGCAGGAACACAAACCCTTCTTCTCGAGAAGAAGGGTTTGTGTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1195s1c1
Sequence:CCGGCCCAAAGATTCTGGCCCAATTCTCGAGAATTGGGCCAGAATCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-1530s21c1
Sequence:CCGGATGAGCTACAGACAACGAATGCTCGAGCATTCGTTGTCTGTAGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-1053s21c1
Sequence:CCGGCCAAGCATGCCACCAATATAACTCGAGTTATATTGGTGGCATGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-603s21c1
Sequence:CCGGTAGAGTTGGAGAAAGTCAATGCTCGAGCATTGACTTTCTCCAACTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148950.2-1854s21c1
Sequence:CCGGGAGATCTGGACTCACCGAATACTCGAGTATTCGGTGAGTCCAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-201s21c1
Sequence:CCGGCAATGATGGCCACGCAGAATGCTCGAGCATTCTGCGTGGCCATCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148950
PKNOX2 MISSION shRNA shRNA Plasmid DNA
PBX/knotted 1 homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1350s1c1
Sequence:CCGGGCACATGATGATTCATTGGATCTCGAGATCCAATGAATCATCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-775s1c1
Sequence:CCGGCCGTCAATTCTCAAGTCGTGTCTCGAGACACGACTTGAGAATTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1067s1c1
Sequence:CCGGCCTCACCCTTCTGCAAGTAAACTCGAGTTTACTTGCAGAAGGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-431s1c1
Sequence:CCGGGCAGGAACACAAACCCTTCTTCTCGAGAAGAAGGGTTTGTGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1195s1c1
Sequence:CCGGCCCAAAGATTCTGGCCCAATTCTCGAGAATTGGGCCAGAATCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-1530s21c1
Sequence:CCGGATGAGCTACAGACAACGAATGCTCGAGCATTCGTTGTCTGTAGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-1053s21c1
Sequence:CCGGCCAAGCATGCCACCAATATAACTCGAGTTATATTGGTGGCATGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-603s21c1
Sequence:CCGGTAGAGTTGGAGAAAGTCAATGCTCGAGCATTGACTTTCTCCAACTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148950.2-1854s21c1
Sequence:CCGGGAGATCTGGACTCACCGAATACTCGAGTATTCGGTGAGTCCAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-201s21c1
Sequence:CCGGCAATGATGGCCACGCAGAATGCTCGAGCATTCTGCGTGGCCATCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148950
PKNOX2 MISSION shRNA Lentiviral Transduction Particles
PBX/knotted 1 homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1350s1c1
Sequence:CCGGGCACATGATGATTCATTGGATCTCGAGATCCAATGAATCATCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-775s1c1
Sequence:CCGGCCGTCAATTCTCAAGTCGTGTCTCGAGACACGACTTGAGAATTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1067s1c1
Sequence:CCGGCCTCACCCTTCTGCAAGTAAACTCGAGTTTACTTGCAGAAGGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-431s1c1
Sequence:CCGGGCAGGAACACAAACCCTTCTTCTCGAGAAGAAGGGTTTGTGTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148950.1-1195s1c1
Sequence:CCGGCCCAAAGATTCTGGCCCAATTCTCGAGAATTGGGCCAGAATCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-1530s21c1
Sequence:CCGGATGAGCTACAGACAACGAATGCTCGAGCATTCGTTGTCTGTAGCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-1053s21c1
Sequence:CCGGCCAAGCATGCCACCAATATAACTCGAGTTATATTGGTGGCATGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-603s21c1
Sequence:CCGGTAGAGTTGGAGAAAGTCAATGCTCGAGCATTGACTTTCTCCAACTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148950.2-1854s21c1
Sequence:CCGGGAGATCTGGACTCACCGAATACTCGAGTATTCGGTGAGTCCAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148950.2-201s21c1
Sequence:CCGGCAATGATGGCCACGCAGAATGCTCGAGCATTCTGCGTGGCCATCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022062
VALIDATED
PKNOX2 MISSION shRNA Bacterial Glycerol Stock
PBX/knotted 1 homeobox 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-793s1c1
Sequence:CCGGGATCCAGAACACACAGGTTAACTCGAGTTAACCTGTGTGTTCTGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-368s1c1
Sequence:CCGGGATGACCCAGAACTGGACAATCTCGAGATTGTCCAGTTCTGGGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-888s1c1
Sequence:CCGGCCACCAATATAATGCGTTCTTCTCGAGAAGAACGCATTATATTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-239s1c1
Sequence:CCGGCTGACGCTGCTGTTTGAGAAACTCGAGTTTCTCAAACAGCAGCGTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022062.1-832s1c1
Sequence:CCGGCCTGGACAATGAGGATAAGAACTCGAGTTCTTATCCTCATTGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022062.2-930s21c1
Sequence:CCGGATGTCCGGAGTCTCCAATAACCTCGAGGTTATTGGAGACTCCGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022062.2-2099s21c1
Sequence:CCGGATTGGTGCTGTTCGCAGAGTACTCGAGTACTCTGCGAACAGCACCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022062.2-1301s21c1
Sequence:CCGGCCTCACCCTCCTGCAAGTAAACTCGAGTTTACTTGCAGGAGGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022062
VALIDATED
PKNOX2 MISSION shRNA shRNA Plasmid DNA
PBX/knotted 1 homeobox 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-793s1c1
Sequence:CCGGGATCCAGAACACACAGGTTAACTCGAGTTAACCTGTGTGTTCTGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-368s1c1
Sequence:CCGGGATGACCCAGAACTGGACAATCTCGAGATTGTCCAGTTCTGGGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-888s1c1
Sequence:CCGGCCACCAATATAATGCGTTCTTCTCGAGAAGAACGCATTATATTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-239s1c1
Sequence:CCGGCTGACGCTGCTGTTTGAGAAACTCGAGTTTCTCAAACAGCAGCGTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022062.1-832s1c1
Sequence:CCGGCCTGGACAATGAGGATAAGAACTCGAGTTCTTATCCTCATTGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022062.2-930s21c1
Sequence:CCGGATGTCCGGAGTCTCCAATAACCTCGAGGTTATTGGAGACTCCGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022062.2-2099s21c1
Sequence:CCGGATTGGTGCTGTTCGCAGAGTACTCGAGTACTCTGCGAACAGCACCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022062.2-1301s21c1
Sequence:CCGGCCTCACCCTCCTGCAAGTAAACTCGAGTTTACTTGCAGGAGGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022062
VALIDATED
PKNOX2 MISSION shRNA Lentiviral Transduction Particles
PBX/knotted 1 homeobox 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-793s1c1
Sequence:CCGGGATCCAGAACACACAGGTTAACTCGAGTTAACCTGTGTGTTCTGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-368s1c1
Sequence:CCGGGATGACCCAGAACTGGACAATCTCGAGATTGTCCAGTTCTGGGTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-888s1c1
Sequence:CCGGCCACCAATATAATGCGTTCTTCTCGAGAAGAACGCATTATATTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022062.1-239s1c1
Sequence:CCGGCTGACGCTGCTGTTTGAGAAACTCGAGTTTCTCAAACAGCAGCGTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022062.1-832s1c1
Sequence:CCGGCCTGGACAATGAGGATAAGAACTCGAGTTCTTATCCTCATTGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022062.2-930s21c1
Sequence:CCGGATGTCCGGAGTCTCCAATAACCTCGAGGTTATTGGAGACTCCGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022062.2-2099s21c1
Sequence:CCGGATTGGTGCTGTTCGCAGAGTACTCGAGTACTCTGCGAACAGCACCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022062.2-1301s21c1
Sequence:CCGGCCTCACCCTCCTGCAAGTAAACTCGAGTTTACTTGCAGGAGGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)