EMAIL THIS PAGE TO A FRIEND

PKP1

plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)

104 Gene Product Result for
Synonyms: B6P
UniProtKB ID: Q13835, O00645, Q14CA0, Q15152
Gene ID:
Human(5317) Summary: This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(18772) plakophilin 1
Rat(304822) plakophilin 1
chicken(421158) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
dog(607140) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Horse(100051894) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
domestic cat(101099353) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
cow(281405) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
sheep(101109291) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
domestic guinea pig(100733998) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
naked mole-rat(101724616) plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000299 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068941 MISSION® esiRNA esiRNA human PKP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000299 Rosetta Predictions human pricing
NM_001005337 Rosetta Predictions human pricing
NM_001107181 Rosetta Predictions rat pricing
NM_019645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184861 predicted 877
2 SASI_Hs01_00184862 predicted 818
3 SASI_Hs01_00184863 predicted 439
4 SASI_Hs01_00184864 predicted 2263
5 SASI_Hs02_00302283 predicted 2014
6 SASI_Hs01_00184865 predicted 1790
7 SASI_Hs01_00184866 predicted 1071
8 SASI_Hs01_00184867 predicted 2431
9 SASI_Hs01_00184868 predicted 1095
10 SASI_Hs01_00184869 predicted 674
11 SASI_Hs01_00184860 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126425 predicted 881
2 SASI_Hs01_00126426 predicted 825
3 SASI_Hs01_00126427 predicted 439
4 SASI_Hs01_00126428 predicted 2205
5 SASI_Hs02_00304851 predicted 1942
6 SASI_Hs01_00126429 predicted 1730
7 SASI_Hs01_00126430 predicted 1072
8 SASI_Hs01_00126431 predicted 2362
9 SASI_Hs01_00126432 predicted 1093
10 SASI_Hs01_00126433 predicted 669
11 SASI_Hs01_00126424 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226305 predicted 1447
2 SASI_Rn02_00226306 predicted 761
3 SASI_Rn02_00226307 predicted 608
4 SASI_Rn02_00226308 predicted 1980
5 SASI_Rn02_00226309 predicted 1690
6 SASI_Rn02_00226310 predicted 2012
7 SASI_Rn02_00226311 predicted 856
8 SASI_Rn02_00226312 predicted 1680
9 SASI_Rn02_00226313 predicted 1355
10 SASI_Rn02_00226314 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084585 predicted 1505
2 SASI_Mm01_00084586 predicted 1275
3 SASI_Mm02_00324687 predicted 1848
4 SASI_Mm01_00084590 predicted 1890
5 SASI_Mm01_00084591 predicted 1756
6 SASI_Mm01_00084592 predicted 1691
7 SASI_Mm01_00084593 predicted 1179
8 SASI_Mm01_00084594 predicted 2077
9 SASI_Mm02_00324688 predicted 1618
10 SASI_Mm02_00324689 predicted 644
11 SASI_Mm01_00084587 predicted 1284
12 SASI_Mm01_00084588 predicted 446
13 SASI_Mm01_00084589 predicted 1863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019645
VALIDATED
PKP1 MISSION shRNA Bacterial Glycerol Stock
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019645.2-206s21c1
Sequence:CCCGCCAACCGAGGTTCCATGTATGCTCGAGCATACATGGAACCTCGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019645.2-1286s21c1
Sequence:CCGGGGAACTACTCTGGGCTCATTGCTCGAGCAATGAGCCCAGAGTAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019645.2-2442s21c1
Sequence:CCGGGGCTTACATCTGATGTCAATACTCGAGTATTGACATCAGATGTAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019645.1-4238s1c1
Sequence:CCGGGCCTCCTAGTTCCATATCTAACTCGAGTTAGATATGGAACTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019645.1-2133s1c1
Sequence:CCGGCGATAGGAATATGATGGGAAACTCGAGTTTCCCATCATATTCCTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019645.1-1701s1c1
Sequence:CCGGCAATGGTATGAGTCAGTTAATCTCGAGATTAACTGACTCATACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019645.1-660s1c1
Sequence:CCGGGCCGCCTATCTCCTGCAACAACTCGAGTTGTTGCAGGAGATAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019645.1-141s1c1
Sequence:CCGGGCAAGTGATGATGACCGTCAACTCGAGTTGACGGTCATCATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019645
VALIDATED
PKP1 MISSION shRNA shRNA Plasmid DNA
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019645.2-206s21c1
Sequence:CCCGCCAACCGAGGTTCCATGTATGCTCGAGCATACATGGAACCTCGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019645.2-1286s21c1
Sequence:CCGGGGAACTACTCTGGGCTCATTGCTCGAGCAATGAGCCCAGAGTAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019645.2-2442s21c1
Sequence:CCGGGGCTTACATCTGATGTCAATACTCGAGTATTGACATCAGATGTAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019645.1-4238s1c1
Sequence:CCGGGCCTCCTAGTTCCATATCTAACTCGAGTTAGATATGGAACTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019645.1-2133s1c1
Sequence:CCGGCGATAGGAATATGATGGGAAACTCGAGTTTCCCATCATATTCCTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019645.1-1701s1c1
Sequence:CCGGCAATGGTATGAGTCAGTTAATCTCGAGATTAACTGACTCATACCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019645.1-660s1c1
Sequence:CCGGGCCGCCTATCTCCTGCAACAACTCGAGTTGTTGCAGGAGATAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019645.1-141s1c1
Sequence:CCGGGCAAGTGATGATGACCGTCAACTCGAGTTGACGGTCATCATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019645
VALIDATED
PKP1 MISSION shRNA Lentiviral Transduction Particles
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019645.2-206s21c1
Sequence:CCCGCCAACCGAGGTTCCATGTATGCTCGAGCATACATGGAACCTCGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019645.2-1286s21c1
Sequence:CCGGGGAACTACTCTGGGCTCATTGCTCGAGCAATGAGCCCAGAGTAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019645.2-2442s21c1
Sequence:CCGGGGCTTACATCTGATGTCAATACTCGAGTATTGACATCAGATGTAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019645.1-4238s1c1
Sequence:CCGGGCCTCCTAGTTCCATATCTAACTCGAGTTAGATATGGAACTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019645.1-2133s1c1
Sequence:CCGGCGATAGGAATATGATGGGAAACTCGAGTTTCCCATCATATTCCTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019645.1-1701s1c1
Sequence:CCGGCAATGGTATGAGTCAGTTAATCTCGAGATTAACTGACTCATACCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019645.1-660s1c1
Sequence:CCGGGCCGCCTATCTCCTGCAACAACTCGAGTTGTTGCAGGAGATAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019645.1-141s1c1
Sequence:CCGGGCAAGTGATGATGACCGTCAACTCGAGTTGACGGTCATCATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000299
PKP1 MISSION shRNA Bacterial Glycerol Stock
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000299.2-2841s21c1
Sequence:CCGGGTGAGTGTCTTAAAGCATAACCTCGAGGTTATGCTTTAAGACACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000299.2-306s21c1
Sequence:CCGGGACAACTCCACGTTGGCTTTGCTCGAGCAAAGCCAACGTGGAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-1743s1c1
Sequence:CCGGCGACAAGATGATGAACAACAACTCGAGTTGTTGTTCATCATCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-679s1c1
Sequence:CCGGGACATCTGCTTCATGCAGAAACTCGAGTTTCTGCATGAAGCAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-1815s1c1
Sequence:CCGGGTTGTACCATTCAGATGCCATCTCGAGATGGCATCTGAATGGTACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-381s1c1
Sequence:CCGGGCAGGTGATGATGACCGTCAACTCGAGTTGACGGTCATCATCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-2358s1c1
Sequence:CCGGGCAAGGTTTCGATAGGAACATCTCGAGATGTTCCTATCGAAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000299
PKP1 MISSION shRNA shRNA Plasmid DNA
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000299.2-2841s21c1
Sequence:CCGGGTGAGTGTCTTAAAGCATAACCTCGAGGTTATGCTTTAAGACACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000299.2-306s21c1
Sequence:CCGGGACAACTCCACGTTGGCTTTGCTCGAGCAAAGCCAACGTGGAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-1743s1c1
Sequence:CCGGCGACAAGATGATGAACAACAACTCGAGTTGTTGTTCATCATCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-679s1c1
Sequence:CCGGGACATCTGCTTCATGCAGAAACTCGAGTTTCTGCATGAAGCAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-1815s1c1
Sequence:CCGGGTTGTACCATTCAGATGCCATCTCGAGATGGCATCTGAATGGTACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-381s1c1
Sequence:CCGGGCAGGTGATGATGACCGTCAACTCGAGTTGACGGTCATCATCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-2358s1c1
Sequence:CCGGGCAAGGTTTCGATAGGAACATCTCGAGATGTTCCTATCGAAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000299
PKP1 MISSION shRNA Lentiviral Transduction Particles
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000299.2-2841s21c1
Sequence:CCGGGTGAGTGTCTTAAAGCATAACCTCGAGGTTATGCTTTAAGACACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000299.2-306s21c1
Sequence:CCGGGACAACTCCACGTTGGCTTTGCTCGAGCAAAGCCAACGTGGAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-1743s1c1
Sequence:CCGGCGACAAGATGATGAACAACAACTCGAGTTGTTGTTCATCATCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-679s1c1
Sequence:CCGGGACATCTGCTTCATGCAGAAACTCGAGTTTCTGCATGAAGCAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-1815s1c1
Sequence:CCGGGTTGTACCATTCAGATGCCATCTCGAGATGGCATCTGAATGGTACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-381s1c1
Sequence:CCGGGCAGGTGATGATGACCGTCAACTCGAGTTGACGGTCATCATCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000299.1-2358s1c1
Sequence:CCGGGCAAGGTTTCGATAGGAACATCTCGAGATGTTCCTATCGAAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)