EMAIL THIS PAGE TO A FRIEND

PKP2

plakophilin 2

103 Gene Product Result for
Synonyms: ARVD9
UniProtKB ID: Q99959, A0AV37, D3DUW9, Q4VC01, Q99960
Gene ID:
Human(5318) Summary: This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]
Mouse(67451) plakophilin 2
Rat(287925) plakophilin 2
Zebrafish(568060) plakophilin 2
Horse(100070065) plakophilin 2
domestic cat(101091710) plakophilin 2
dog(486613) plakophilin 2
chicken(418130) plakophilin 2
cow(537784) plakophilin 2
sheep(101104733) plakophilin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004572 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005242 Rosetta Predictions human pricing
NM_004572 Rosetta Predictions human pricing
XM_001065241 Rosetta Predictions rat pricing
XM_213560 Rosetta Predictions rat pricing
NM_026163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140637 predicted 1761
2 SASI_Hs02_00304807 predicted 2288
3 SASI_Hs01_00140639 predicted 2033
4 SASI_Hs01_00140640 predicted 1775
5 SASI_Hs01_00140641 predicted 441
6 SASI_Hs01_00140642 predicted 600
7 SASI_Hs01_00140643 predicted 680
8 SASI_Hs01_00140644 predicted 590
9 SASI_Hs01_00140645 predicted 2236
10 SASI_Hs01_00140646 predicted 2543
11 SASI_Hs01_00140638 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037839 predicted 1890
2 SASI_Hs02_00337909 predicted 2426
3 SASI_Hs01_00037841 predicted 2160
4 SASI_Hs01_00037842 predicted 1906
5 SASI_Hs01_00037843 predicted 436
6 SASI_Hs01_00037844 predicted 600
7 SASI_Hs01_00037845 predicted 683
8 SASI_Hs01_00037846 predicted 585
9 SASI_Hs01_00037847 predicted 2371
10 SASI_Hs01_00037848 predicted 2679
11 SASI_Hs01_00037840 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313368 predicted 1469
2 SASI_Rn02_00313369 predicted 1843
3 SASI_Rn02_00313370 predicted 1696
4 SASI_Rn02_00313371 predicted 2187
5 SASI_Rn02_00313372 predicted 1612
6 SASI_Rn02_00313373 predicted 1582
7 SASI_Rn02_00313374 predicted 966
8 SASI_Rn02_00313375 predicted 1196
9 SASI_Rn02_00313376 predicted 1457
10 SASI_Rn02_00313377 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374726 predicted 306
2 SASI_Rn02_00374727 predicted 688
3 SASI_Rn02_00374728 predicted 544
4 SASI_Rn02_00374729 predicted 1040
5 SASI_Rn02_00374730 predicted 457
6 SASI_Rn02_00374731 predicted 429
7 SASI_Rn02_00374732 predicted 511
8 SASI_Rn02_00374733 predicted 914
9 SASI_Rn02_00374734 predicted 437
10 SASI_Rn02_00374735 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046723 predicted 1819
2 SASI_Mm01_00046724 predicted 1671
3 SASI_Mm01_00046725 predicted 1103
4 SASI_Mm01_00046726 predicted 2163
5 SASI_Mm01_00046727 predicted 1436
6 SASI_Mm01_00046728 predicted 1272
7 SASI_Mm01_00046729 predicted 1544
8 SASI_Mm01_00046730 predicted 1559
9 SASI_Mm02_00329789 predicted 1158
10 SASI_Mm01_00046731 predicted 989
11 SASI_Mm01_00046732 predicted 1779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026163
VALIDATED
PKP2 MISSION shRNA Bacterial Glycerol Stock
plakophilin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026163.1-2697s1c1
Sequence:CCGGGCATCATTATTCAGGCTTATACTCGAGTATAAGCCTGAATAATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026163.1-1155s1c1
Sequence:CCGGGCCTTGAGAAACTTGGTATTTCTCGAGAAATACCAAGTTTCTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-279s1c1
Sequence:CCGGCCTGAGTATGTCTACAAGCTACTCGAGTAGCTTGTAGACATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-958s1c1
Sequence:CCGGCCTTGGAGAGAGCTGTGAATACTCGAGTATTCACAGCTCTCTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-2337s1c1
Sequence:CCGGGCCTATAAGAAGGCTCAGTTTCTCGAGAAACTGAGCCTTCTTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-278s21c1
Sequence:CCGGCCTGAGTATGTCTACAAGCTACTCGAGTAGCTTGTAGACATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-1154s21c1
Sequence:CCGGGCCTTGAGAAACTTGGTATTTCTCGAGAAATACCAAGTTTCTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-2156s21c1
Sequence:CCGGTGCTATACGTTGAACAATTTACTCGAGTAAATTGTTCAACGTATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026163.2-2451s21c1
Sequence:CCGGTTTCACAGTTCTCCACTTAAACTCGAGTTTAAGTGGAGAACTGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026163
VALIDATED
PKP2 MISSION shRNA shRNA Plasmid DNA
plakophilin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026163.1-2697s1c1
Sequence:CCGGGCATCATTATTCAGGCTTATACTCGAGTATAAGCCTGAATAATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026163.1-1155s1c1
Sequence:CCGGGCCTTGAGAAACTTGGTATTTCTCGAGAAATACCAAGTTTCTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-279s1c1
Sequence:CCGGCCTGAGTATGTCTACAAGCTACTCGAGTAGCTTGTAGACATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-958s1c1
Sequence:CCGGCCTTGGAGAGAGCTGTGAATACTCGAGTATTCACAGCTCTCTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-2337s1c1
Sequence:CCGGGCCTATAAGAAGGCTCAGTTTCTCGAGAAACTGAGCCTTCTTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-278s21c1
Sequence:CCGGCCTGAGTATGTCTACAAGCTACTCGAGTAGCTTGTAGACATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-1154s21c1
Sequence:CCGGGCCTTGAGAAACTTGGTATTTCTCGAGAAATACCAAGTTTCTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-2156s21c1
Sequence:CCGGTGCTATACGTTGAACAATTTACTCGAGTAAATTGTTCAACGTATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026163.2-2451s21c1
Sequence:CCGGTTTCACAGTTCTCCACTTAAACTCGAGTTTAAGTGGAGAACTGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026163
VALIDATED
PKP2 MISSION shRNA Lentiviral Transduction Particles
plakophilin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026163.1-2697s1c1
Sequence:CCGGGCATCATTATTCAGGCTTATACTCGAGTATAAGCCTGAATAATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026163.1-1155s1c1
Sequence:CCGGGCCTTGAGAAACTTGGTATTTCTCGAGAAATACCAAGTTTCTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-279s1c1
Sequence:CCGGCCTGAGTATGTCTACAAGCTACTCGAGTAGCTTGTAGACATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-958s1c1
Sequence:CCGGCCTTGGAGAGAGCTGTGAATACTCGAGTATTCACAGCTCTCTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026163.1-2337s1c1
Sequence:CCGGGCCTATAAGAAGGCTCAGTTTCTCGAGAAACTGAGCCTTCTTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-278s21c1
Sequence:CCGGCCTGAGTATGTCTACAAGCTACTCGAGTAGCTTGTAGACATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-1154s21c1
Sequence:CCGGGCCTTGAGAAACTTGGTATTTCTCGAGAAATACCAAGTTTCTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026163.2-2156s21c1
Sequence:CCGGTGCTATACGTTGAACAATTTACTCGAGTAAATTGTTCAACGTATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026163.2-2451s21c1
Sequence:CCGGTTTCACAGTTCTCCACTTAAACTCGAGTTTAAGTGGAGAACTGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004572
PKP2 MISSION shRNA Bacterial Glycerol Stock
plakophilin 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-1171s1c1
Sequence:CCGGCCAGAAATCTGAAGCTCGGAACTCGAGTTCCGAGCTTCAGATTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-275s1c1
Sequence:CCGGCCTGAGTATGTCTACAACCTACTCGAGTAGGTTGTAGACATACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-1892s1c1
Sequence:CCGGCCAGAGAAATATTCCCAGAATCTCGAGATTCTGGGAATATTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2410s1c1
Sequence:CCGGCTGTTACACATTGAACAACATCTCGAGATGTTGTTCAATGTGTAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2519s1c1
Sequence:CCGGGCCTCCAACAAAGCAAGTAAACTCGAGTTTACTTGCTTTGTTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2591s1c1
Sequence:CCGGGCCTACAAGAAGGCTCAGTTTCTCGAGAAACTGAGCCTTCTTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1783s21c1
Sequence:CCGGCAACGTCACTGGATGCCTAAGCTCGAGCTTAGGCATCCAGTGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-2987s21c1
Sequence:CCGGGTCTTTGTTATTAGGGCTTATCTCGAGATAAGCCCTAATAACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1686s21c1
Sequence:CCGGTGCTTACGCTGACGGAGAATACTCGAGTATTCTCCGTCAGCGTAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-593s21c1
Sequence:CCGGCACTACACGCACAGCGATTACCTCGAGGTAATCGCTGTGCGTGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-3049s21c1
Sequence:CCGGAGGGACATTAATCCAATAAATCTCGAGATTTATTGGATTAATGTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-2467s21c1
Sequence:CCGGTACTGACCTTCTCATTGAAACCTCGAGGTTTCAATGAGAAGGTCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1885s21c1
Sequence:CCGGCAGAGGAACCATTGCAGATTACTCGAGTAATCTGCAATGGTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1490s21c1
Sequence:CCGGACAGACCATACAGTCAATTTACTCGAGTAAATTGACTGTATGGTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-3173s21c1
Sequence:CCGGCATTGGGCCTCCAGTGTATTGCTCGAGCAATACACTGGAGGCCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004572
PKP2 MISSION shRNA shRNA Plasmid DNA
plakophilin 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-1171s1c1
Sequence:CCGGCCAGAAATCTGAAGCTCGGAACTCGAGTTCCGAGCTTCAGATTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-275s1c1
Sequence:CCGGCCTGAGTATGTCTACAACCTACTCGAGTAGGTTGTAGACATACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-1892s1c1
Sequence:CCGGCCAGAGAAATATTCCCAGAATCTCGAGATTCTGGGAATATTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2410s1c1
Sequence:CCGGCTGTTACACATTGAACAACATCTCGAGATGTTGTTCAATGTGTAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2519s1c1
Sequence:CCGGGCCTCCAACAAAGCAAGTAAACTCGAGTTTACTTGCTTTGTTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2591s1c1
Sequence:CCGGGCCTACAAGAAGGCTCAGTTTCTCGAGAAACTGAGCCTTCTTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1783s21c1
Sequence:CCGGCAACGTCACTGGATGCCTAAGCTCGAGCTTAGGCATCCAGTGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-2987s21c1
Sequence:CCGGGTCTTTGTTATTAGGGCTTATCTCGAGATAAGCCCTAATAACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1686s21c1
Sequence:CCGGTGCTTACGCTGACGGAGAATACTCGAGTATTCTCCGTCAGCGTAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-593s21c1
Sequence:CCGGCACTACACGCACAGCGATTACCTCGAGGTAATCGCTGTGCGTGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-3049s21c1
Sequence:CCGGAGGGACATTAATCCAATAAATCTCGAGATTTATTGGATTAATGTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-2467s21c1
Sequence:CCGGTACTGACCTTCTCATTGAAACCTCGAGGTTTCAATGAGAAGGTCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1885s21c1
Sequence:CCGGCAGAGGAACCATTGCAGATTACTCGAGTAATCTGCAATGGTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1490s21c1
Sequence:CCGGACAGACCATACAGTCAATTTACTCGAGTAAATTGACTGTATGGTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-3173s21c1
Sequence:CCGGCATTGGGCCTCCAGTGTATTGCTCGAGCAATACACTGGAGGCCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004572
PKP2 MISSION shRNA Lentiviral Transduction Particles
plakophilin 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-1171s1c1
Sequence:CCGGCCAGAAATCTGAAGCTCGGAACTCGAGTTCCGAGCTTCAGATTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-275s1c1
Sequence:CCGGCCTGAGTATGTCTACAACCTACTCGAGTAGGTTGTAGACATACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-1892s1c1
Sequence:CCGGCCAGAGAAATATTCCCAGAATCTCGAGATTCTGGGAATATTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2410s1c1
Sequence:CCGGCTGTTACACATTGAACAACATCTCGAGATGTTGTTCAATGTGTAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2519s1c1
Sequence:CCGGGCCTCCAACAAAGCAAGTAAACTCGAGTTTACTTGCTTTGTTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004572.1-2591s1c1
Sequence:CCGGGCCTACAAGAAGGCTCAGTTTCTCGAGAAACTGAGCCTTCTTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1783s21c1
Sequence:CCGGCAACGTCACTGGATGCCTAAGCTCGAGCTTAGGCATCCAGTGACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-2987s21c1
Sequence:CCGGGTCTTTGTTATTAGGGCTTATCTCGAGATAAGCCCTAATAACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1686s21c1
Sequence:CCGGTGCTTACGCTGACGGAGAATACTCGAGTATTCTCCGTCAGCGTAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-593s21c1
Sequence:CCGGCACTACACGCACAGCGATTACCTCGAGGTAATCGCTGTGCGTGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-3049s21c1
Sequence:CCGGAGGGACATTAATCCAATAAATCTCGAGATTTATTGGATTAATGTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-2467s21c1
Sequence:CCGGTACTGACCTTCTCATTGAAACCTCGAGGTTTCAATGAGAAGGTCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1885s21c1
Sequence:CCGGCAGAGGAACCATTGCAGATTACTCGAGTAATCTGCAATGGTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004572.3-1490s21c1
Sequence:CCGGACAGACCATACAGTCAATTTACTCGAGTAAATTGACTGTATGGTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004572.3-3173s21c1
Sequence:CCGGCATTGGGCCTCCAGTGTATTGCTCGAGCAATACACTGGAGGCCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)