EMAIL THIS PAGE TO A FRIEND

PLA1A

phospholipase A1 member A

108 Gene Product Result for
Synonyms: PS-PLA1 PSPLA1
UniProtKB ID: Q53H76, B2R8V2, B4DXA2, O95991, Q86WX6, Q9UPD2
Gene ID:
Human(51365) Summary: The protein encoded by this gene is a phospholipase that hydrolyzes fatty acids at the sn-1 position of phosphatidylserine and 1-acyl-2-lysophosphatidylserine. This secreted protein hydrolyzes phosphatidylserine in liposomes. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Mouse(85031) phospholipase A1 member A
Rat(85311) phospholipase A1 member A
Zebrafish(334017) phospholipase A1 member A
chicken(770199) phospholipase A1 member A
dog(100686158) phospholipase A1 member A
domestic cat(101101581) phospholipase A1 member A
cow(515900) phospholipase A1 member A
sheep(101106480) phospholipase A1 member A
domestic guinea pig(100719689) phospholipase A1 member A
naked mole-rat(101703405) phospholipase A1 member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025061 MISSION® esiRNA esiRNA targeting mouse Pla1a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015900 Rosetta Predictions human pricing
NM_138882 Rosetta Predictions rat pricing
NM_134102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063696 predicted 409
2 SASI_Hs01_00063697 predicted 781
3 SASI_Hs01_00063698 predicted 501
4 SASI_Hs01_00063699 predicted 1100
5 SASI_Hs01_00063701 predicted 1139
6 SASI_Hs01_00063702 predicted 389
7 SASI_Hs01_00063703 predicted 683
8 SASI_Hs01_00063704 predicted 1087
9 SASI_Hs01_00063705 predicted 370
10 SASI_Hs02_00348489 predicted 401
11 SASI_Hs01_00063700 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039669 predicted 1125
2 SASI_Rn02_00268313 predicted 1452
3 SASI_Rn01_00039671 predicted 276
4 SASI_Rn02_00268314 predicted 767
5 SASI_Rn01_00039672 predicted 1115
6 SASI_Rn01_00039673 predicted 671
7 SASI_Rn01_00039674 predicted 758
8 SASI_Rn02_00268315 predicted 698
9 SASI_Rn01_00039675 predicted 985
10 SASI_Rn01_00039676 predicted 1108
11 SASI_Rn01_00039670 predicted 487
12 SASI_Rn01_00039677 predicted 1439
13 SASI_Rn01_00039678 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068724 predicted 740
2 SASI_Mm01_00068725 predicted 1690
3 SASI_Mm01_00068726 predicted 637
4 SASI_Mm01_00068728 predicted 920
5 SASI_Mm01_00068729 predicted 513
6 SASI_Mm02_00339336 predicted 1355
7 SASI_Mm02_00339337 predicted 1368
8 SASI_Mm01_00068731 predicted 792
9 SASI_Mm01_00068733 predicted 1545
10 SASI_Mm02_00339338 predicted 1240
11 SASI_Mm01_00068727 predicted 1479
12 SASI_Mm01_00068730 predicted 485
13 SASI_Mm01_00068732 predicted 1374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015900
PLA1A MISSION shRNA Bacterial Glycerol Stock
phospholipase A1 member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015900.2-1595s21c1
Sequence:CCGGGGTTTCCTTTGCCGATCTTATCTCGAGATAAGATCGGCAAAGGAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015900.2-785s21c1
Sequence:CCGGTTTACGCAGGTTATAGTTATCCTCGAGGATAACTATAACCTGCGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015900.1-1482s1c1
Sequence:CCGGGCAGCTTATTGTAGACCATTACTCGAGTAATGGTCTACAATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-1205s1c1
Sequence:CCGGTGCCAGATAAACCAAGTGAAACTCGAGTTTCACTTGGTTTATCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-1206s1c1
Sequence:CCGGGCCAGATAAACCAAGTGAAATCTCGAGATTTCACTTGGTTTATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-323s1c1
Sequence:CCGGCCTTCCTGGATTGACACATTTCTCGAGAAATGTGTCAATCCAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-679s1c1
Sequence:CCGGCCACACAGACACCGACAATTTCTCGAGAAATTGTCGGTGTCTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015900
PLA1A MISSION shRNA shRNA Plasmid DNA
phospholipase A1 member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015900.2-1595s21c1
Sequence:CCGGGGTTTCCTTTGCCGATCTTATCTCGAGATAAGATCGGCAAAGGAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015900.2-785s21c1
Sequence:CCGGTTTACGCAGGTTATAGTTATCCTCGAGGATAACTATAACCTGCGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015900.1-1482s1c1
Sequence:CCGGGCAGCTTATTGTAGACCATTACTCGAGTAATGGTCTACAATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-1205s1c1
Sequence:CCGGTGCCAGATAAACCAAGTGAAACTCGAGTTTCACTTGGTTTATCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-1206s1c1
Sequence:CCGGGCCAGATAAACCAAGTGAAATCTCGAGATTTCACTTGGTTTATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-323s1c1
Sequence:CCGGCCTTCCTGGATTGACACATTTCTCGAGAAATGTGTCAATCCAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-679s1c1
Sequence:CCGGCCACACAGACACCGACAATTTCTCGAGAAATTGTCGGTGTCTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015900
PLA1A MISSION shRNA Lentiviral Transduction Particles
phospholipase A1 member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015900.2-1595s21c1
Sequence:CCGGGGTTTCCTTTGCCGATCTTATCTCGAGATAAGATCGGCAAAGGAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015900.2-785s21c1
Sequence:CCGGTTTACGCAGGTTATAGTTATCCTCGAGGATAACTATAACCTGCGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015900.1-1482s1c1
Sequence:CCGGGCAGCTTATTGTAGACCATTACTCGAGTAATGGTCTACAATAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-1205s1c1
Sequence:CCGGTGCCAGATAAACCAAGTGAAACTCGAGTTTCACTTGGTTTATCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-1206s1c1
Sequence:CCGGGCCAGATAAACCAAGTGAAATCTCGAGATTTCACTTGGTTTATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-323s1c1
Sequence:CCGGCCTTCCTGGATTGACACATTTCTCGAGAAATGTGTCAATCCAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015900.1-679s1c1
Sequence:CCGGCCACACAGACACCGACAATTTCTCGAGAAATTGTCGGTGTCTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134102
PLA1A MISSION shRNA Bacterial Glycerol Stock
phospholipase A1 member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-917s21c1
Sequence:CCGGCCACACAGACACGGACAATTTCTCGAGAAATTGTCCGTGTCTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-1019s21c1
Sequence:CCGGCGCAGGTTACAATTACTTGATCTCGAGATCAAGTAATTGTAACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-1341s1c2
Sequence:CCGGCGAGGTCACGTTTCTTAGCAACTCGAGTTGCTAAGAAACGTGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134102.4-1836s21c1
Sequence:CCGGCGCTTTACATAAATGCCCTTTCTCGAGAAAGGGCATTTATGTAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-560s21c1
Sequence:CCGGGCCTTCTTGGATCGACAAGTTCTCGAGAACTTGTCGATCCAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-561s1c1
Sequence:CCGGGCCTTCTTGGATCGACAAGTTCTCGAGAACTTGTCGATCCAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134102.2-1837s1c1
Sequence:CCGGCGCTTTACATAAATGCCCTTTCTCGAGAAAGGGCATTTATGTAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-1020s1c1
Sequence:CCGGCGCAGGTTACAATTACTTGATCTCGAGATCAAGTAATTGTAACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-918s1c1
Sequence:CCGGCCACACAGACACGGACAATTTCTCGAGAAATTGTCCGTGTCTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134102
PLA1A MISSION shRNA shRNA Plasmid DNA
phospholipase A1 member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-917s21c1
Sequence:CCGGCCACACAGACACGGACAATTTCTCGAGAAATTGTCCGTGTCTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-1019s21c1
Sequence:CCGGCGCAGGTTACAATTACTTGATCTCGAGATCAAGTAATTGTAACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-1341s1c2
Sequence:CCGGCGAGGTCACGTTTCTTAGCAACTCGAGTTGCTAAGAAACGTGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134102.4-1836s21c1
Sequence:CCGGCGCTTTACATAAATGCCCTTTCTCGAGAAAGGGCATTTATGTAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-560s21c1
Sequence:CCGGGCCTTCTTGGATCGACAAGTTCTCGAGAACTTGTCGATCCAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-561s1c1
Sequence:CCGGGCCTTCTTGGATCGACAAGTTCTCGAGAACTTGTCGATCCAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134102.2-1837s1c1
Sequence:CCGGCGCTTTACATAAATGCCCTTTCTCGAGAAAGGGCATTTATGTAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-1020s1c1
Sequence:CCGGCGCAGGTTACAATTACTTGATCTCGAGATCAAGTAATTGTAACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-918s1c1
Sequence:CCGGCCACACAGACACGGACAATTTCTCGAGAAATTGTCCGTGTCTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134102
PLA1A MISSION shRNA Lentiviral Transduction Particles
phospholipase A1 member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-917s21c1
Sequence:CCGGCCACACAGACACGGACAATTTCTCGAGAAATTGTCCGTGTCTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-1019s21c1
Sequence:CCGGCGCAGGTTACAATTACTTGATCTCGAGATCAAGTAATTGTAACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-1341s1c2
Sequence:CCGGCGAGGTCACGTTTCTTAGCAACTCGAGTTGCTAAGAAACGTGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134102.4-1836s21c1
Sequence:CCGGCGCTTTACATAAATGCCCTTTCTCGAGAAAGGGCATTTATGTAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134102.4-560s21c1
Sequence:CCGGGCCTTCTTGGATCGACAAGTTCTCGAGAACTTGTCGATCCAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-561s1c1
Sequence:CCGGGCCTTCTTGGATCGACAAGTTCTCGAGAACTTGTCGATCCAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134102.2-1837s1c1
Sequence:CCGGCGCTTTACATAAATGCCCTTTCTCGAGAAAGGGCATTTATGTAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-1020s1c1
Sequence:CCGGCGCAGGTTACAATTACTTGATCTCGAGATCAAGTAATTGTAACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134102.2-918s1c1
Sequence:CCGGCCACACAGACACGGACAATTTCTCGAGAAATTGTCCGTGTCTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)