EMAIL THIS PAGE TO A FRIEND

PLA2G12A

phospholipase A2, group XIIA

77 Gene Product Result for
Synonyms: GXII PLA2G12 ROSSY
UniProtKB ID: Q9BZM1, Q9BZ89
Gene ID:
Human(81579) Summary: Secreted phospholipase A2 (sPLA2) enzymes liberate arachidonic acid from phospholipids for production of eicosanoids and exert a variety of physiologic and pathologic effects. Group XII sPLA2s, such as PLA2G12A, have relatively low specific activity and are structurally and functionally distinct from other sPLA2s (Gelb et al., 2000 [PubMed 11031251]
Mouse(66350) phospholipase A2, group XIIA
Rat(362039) phospholipase A2, group XIIA
cow(527214) phospholipase A2, group XIIA
sheep(101119561) phospholipase A2, group XIIA
domestic guinea pig(100713638) phospholipase A2, group XIIA
naked mole-rat(101706727) phospholipase A2, group XIIA
Zebrafish(402802) phospholipase A2, group XIIA
domestic cat(101083843) phospholipase A2, group XIIA
dog(478514) phospholipase A2, group XIIA
chicken(772082) phospholipase A2, group XIIA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030821 Rosetta Predictions human pricing
NM_001108565 Rosetta Predictions rat pricing
NM_023196 Rosetta Predictions mouse pricing
NM_183423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192776 predicted 842
2 SASI_Hs01_00192777 predicted 1003
3 SASI_Hs01_00192778 predicted 1045
4 SASI_Hs01_00192779 predicted 1049
5 SASI_Hs01_00192780 predicted 1033
6 SASI_Hs01_00192781 predicted 1020
7 SASI_Hs01_00192782 predicted 1039
8 SASI_Hs01_00192783 predicted 1031
9 SASI_Hs02_00358408 predicted 643
10 SASI_Hs01_00192784 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239889 predicted 563
2 SASI_Rn02_00239890 predicted 827
3 SASI_Rn02_00239891 predicted 882
4 SASI_Rn02_00239892 predicted 615
5 SASI_Rn02_00239893 predicted 785
6 SASI_Rn02_00239894 predicted 551
7 SASI_Rn02_00239895 predicted 335
8 SASI_Rn02_00239896 predicted 319
9 SASI_Rn02_00239897 predicted 527
10 SASI_Rn02_00239898 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326922 predicted 740
2 SASI_Mm02_00326923 predicted 949
3 SASI_Mm02_00326924 predicted 964
4 SASI_Mm01_00175576 predicted 590
5 SASI_Mm02_00326925 predicted 704
6 SASI_Mm01_00175579 predicted 595
7 SASI_Mm02_00326926 predicted 584
8 SASI_Mm01_00175578 predicted 741
9 SASI_Mm01_00175583 predicted 726
10 SASI_Mm01_00175584 predicted 724
11 SASI_Mm01_00175575 predicted 694
12 SASI_Mm01_00175577 predicted 471
13 SASI_Mm01_00175580 predicted 701
14 SASI_Mm01_00175581 predicted 356
15 SASI_Mm01_00175582 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350522 predicted 538
2 SASI_Mm02_00350523 predicted 751
3 SASI_Mm02_00350524 predicted 758
4 SASI_Mm01_00072985 predicted 388
5 SASI_Mm02_00350525 predicted 502
6 SASI_Mm02_00350526 predicted 391
7 SASI_Mm02_00350527 predicted 391
8 SASI_Mm02_00350528 predicted 542
9 SASI_Mm02_00350529 predicted 533
10 SASI_Mm02_00350530 predicted 530
11 SASI_Mm01_00072976 predicted 196
12 SASI_Mm01_00072977 predicted 227
13 SASI_Mm01_00072978 predicted 230
14 SASI_Mm01_00072979 predicted 241
15 SASI_Mm01_00072980 predicted 240
16 SASI_Mm01_00072981 predicted 232
17 SASI_Mm01_00072982 predicted 230
18 SASI_Mm01_00072983 predicted 92
19 SASI_Mm01_00072984 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030821
VALIDATED
PLA2G12A MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group XIIA
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-813s21c1
Sequence:CCGGGCAGGTGTCATTATGAAGAAACTCGAGTTTCTTCATAATGACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-716s21c1
Sequence:CCGGCAGCATGTTCAGGCATGTGAACTCGAGTTCACATGCCTGAACATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-545s21c1
Sequence:CCGGCCACTGTTTGGTGTTCATCTTCTCGAGAAGATGAACACCAAACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-635s21c1
Sequence:CCGGAGCAAGAATGACTGTGATGAACTCGAGTTCATCACAGTCATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-514s1c1
Sequence:CCGGCCACTGTTTGGTGTTCATCTTCTCGAGAAGATGAACACCAAACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030821.3-604s1c1
Sequence:CCGGAGCAAGAATGACTGTGATGAACTCGAGTTCATCACAGTCATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030821.3-369s1c1
Sequence:CCGGCGTTCATAAGATAGACACGTACTCGAGTACGTGTCTATCTTATGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-782s1c1
Sequence:CCGGGCAGGTGTCATTATGAAGAAACTCGAGTTTCTTCATAATGACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-685s1c1
Sequence:CCGGCAGCATGTTCAGGCATGTGAACTCGAGTTCACATGCCTGAACATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030821
VALIDATED
PLA2G12A MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group XIIA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-813s21c1
Sequence:CCGGGCAGGTGTCATTATGAAGAAACTCGAGTTTCTTCATAATGACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-716s21c1
Sequence:CCGGCAGCATGTTCAGGCATGTGAACTCGAGTTCACATGCCTGAACATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-545s21c1
Sequence:CCGGCCACTGTTTGGTGTTCATCTTCTCGAGAAGATGAACACCAAACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-635s21c1
Sequence:CCGGAGCAAGAATGACTGTGATGAACTCGAGTTCATCACAGTCATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-514s1c1
Sequence:CCGGCCACTGTTTGGTGTTCATCTTCTCGAGAAGATGAACACCAAACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030821.3-604s1c1
Sequence:CCGGAGCAAGAATGACTGTGATGAACTCGAGTTCATCACAGTCATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030821.3-369s1c1
Sequence:CCGGCGTTCATAAGATAGACACGTACTCGAGTACGTGTCTATCTTATGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-782s1c1
Sequence:CCGGGCAGGTGTCATTATGAAGAAACTCGAGTTTCTTCATAATGACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-685s1c1
Sequence:CCGGCAGCATGTTCAGGCATGTGAACTCGAGTTCACATGCCTGAACATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030821
VALIDATED
PLA2G12A MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group XIIA
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-813s21c1
Sequence:CCGGGCAGGTGTCATTATGAAGAAACTCGAGTTTCTTCATAATGACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-716s21c1
Sequence:CCGGCAGCATGTTCAGGCATGTGAACTCGAGTTCACATGCCTGAACATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-545s21c1
Sequence:CCGGCCACTGTTTGGTGTTCATCTTCTCGAGAAGATGAACACCAAACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030821.4-635s21c1
Sequence:CCGGAGCAAGAATGACTGTGATGAACTCGAGTTCATCACAGTCATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-514s1c1
Sequence:CCGGCCACTGTTTGGTGTTCATCTTCTCGAGAAGATGAACACCAAACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030821.3-604s1c1
Sequence:CCGGAGCAAGAATGACTGTGATGAACTCGAGTTCATCACAGTCATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030821.3-369s1c1
Sequence:CCGGCGTTCATAAGATAGACACGTACTCGAGTACGTGTCTATCTTATGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-782s1c1
Sequence:CCGGGCAGGTGTCATTATGAAGAAACTCGAGTTTCTTCATAATGACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030821.3-685s1c1
Sequence:CCGGCAGCATGTTCAGGCATGTGAACTCGAGTTCACATGCCTGAACATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023196
VALIDATED
PLA2G12A MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group XIIA
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023196.2-1162s1c1
Sequence:CCGGGCCCACTAAGATAGGTATAAACTCGAGTTTATACCTATCTTAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-221s1c1
Sequence:CCGGCCACAAGATAGACACGTACCTCTCGAGAGGTACGTGTCTATCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-224s1c1
Sequence:CCGGCAAGATAGACACGTACCTCAACTCGAGTTGAGGTACGTGTCTATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-373s1c1
Sequence:CCGGGCGTTCATCTGAACATAGGTACTCGAGTACCTATGTTCAGATGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-631s1c1
Sequence:CCGGGCTGGTGTCGTTATGAAGAAACTCGAGTTTCTTCATAACGACACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023196
VALIDATED
PLA2G12A MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group XIIA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023196.2-1162s1c1
Sequence:CCGGGCCCACTAAGATAGGTATAAACTCGAGTTTATACCTATCTTAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-221s1c1
Sequence:CCGGCCACAAGATAGACACGTACCTCTCGAGAGGTACGTGTCTATCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-224s1c1
Sequence:CCGGCAAGATAGACACGTACCTCAACTCGAGTTGAGGTACGTGTCTATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-373s1c1
Sequence:CCGGGCGTTCATCTGAACATAGGTACTCGAGTACCTATGTTCAGATGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-631s1c1
Sequence:CCGGGCTGGTGTCGTTATGAAGAAACTCGAGTTTCTTCATAACGACACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023196
VALIDATED
PLA2G12A MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group XIIA
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023196.2-1162s1c1
Sequence:CCGGGCCCACTAAGATAGGTATAAACTCGAGTTTATACCTATCTTAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-221s1c1
Sequence:CCGGCCACAAGATAGACACGTACCTCTCGAGAGGTACGTGTCTATCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-224s1c1
Sequence:CCGGCAAGATAGACACGTACCTCAACTCGAGTTGAGGTACGTGTCTATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-373s1c1
Sequence:CCGGGCGTTCATCTGAACATAGGTACTCGAGTACCTATGTTCAGATGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023196.2-631s1c1
Sequence:CCGGGCTGGTGTCGTTATGAAGAAACTCGAGTTTCTTCATAACGACACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)