EMAIL THIS PAGE TO A FRIEND

PLA2G15

phospholipase A2, group XV

172 Gene Product Result for
Synonyms: ACS GXVPLA2 LLPL LPLA2 LYPLA3
UniProtKB ID: Q8NCC3, B3KMF3, Q53GZ1, Q9NPQ6, Q9UG04, Q9Y2B3
Gene ID:
Human(23659) Summary: Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, Jul 2008]
Mouse(192654) phospholipase A2, group XV
Rat(361401) phospholipase A2, group XV
cow(282271) phospholipase A2, group XV
sheep(101118294) phospholipase A2, group XV
domestic guinea pig(100727869) phospholipase A2, group XV
naked mole-rat(101698711) phospholipase A2, group XV
Domestic Rabbit(100355284) phospholipase A2, group XV
Zebrafish(335008) phospholipase A2, group XV
chicken(768530) phospholipase A2, group XV
domestic cat(101092977) phospholipase A2, group XV
Horse(100053908) phospholipase A2, group XV
dog(403403) phospholipase A2, group XV
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012320 Rosetta Predictions human pricing
NM_001004277 Rosetta Predictions rat pricing
XM_579135 Rosetta Predictions rat pricing
NM_133792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078772 predicted 1370
2 SASI_Hs01_00078773 predicted 270
3 SASI_Hs01_00078774 predicted 912
4 SASI_Hs01_00078775 predicted 284
5 SASI_Hs01_00078776 predicted 1152
6 SASI_Hs01_00078777 predicted 1399
7 SASI_Hs01_00078778 predicted 224
8 SASI_Hs02_00344104 predicted 1398
9 SASI_Hs01_00078779 predicted 300
10 SASI_Hs02_00344105 predicted 674
11 SASI_Hs01_00078770 predicted 1695
12 SASI_Hs01_00078771 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046324 predicted 1035
2 SASI_Rn01_00046325 predicted 1251
3 SASI_Rn01_00046326 predicted 226
4 SASI_Rn01_00046327 predicted 623
5 SASI_Rn01_00046328 predicted 782
6 SASI_Rn01_00046329 predicted 341
7 SASI_Rn01_00046330 predicted 1357
8 SASI_Rn02_00198315 predicted 768
9 SASI_Rn01_00046332 predicted 539
10 SASI_Rn01_00046333 predicted 932
11 SASI_Rn01_00046331 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149164 predicted 1018
2 SASI_Rn01_00149165 predicted 225
3 SASI_Rn01_00149166 predicted 311
4 SASI_Rn01_00149167 predicted 203
5 SASI_Rn01_00149168 predicted 767
6 SASI_Rn01_00149169 predicted 230
7 SASI_Rn01_00149170 predicted 402
8 SASI_Rn01_00149171 predicted 313
9 SASI_Rn01_00149172 predicted 1005
10 SASI_Rn01_00149173 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338817 predicted 484
2 SASI_Mm01_00135184 predicted 283
3 SASI_Mm01_00135185 predicted 845
4 SASI_Mm01_00135186 predicted 947
5 SASI_Mm01_00135187 predicted 1094
6 SASI_Mm01_00135188 predicted 222
7 SASI_Mm02_00338818 predicted 834
8 SASI_Mm01_00135189 predicted 1024
9 SASI_Mm01_00135190 predicted 1260
10 SASI_Mm01_00135192 predicted 1257
11 SASI_Mm01_00135191 predicted 484
12 SASI_Mm01_00135193 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012320
VALIDATED
PLA2G15 MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group XV
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-288s21c1
Sequence:CCGGACCGAAAGCTACTTCACAATCCTCGAGGATTGTGAAGTAGCTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-1529s21c1
Sequence:CCGGGGACACTGGATGGCAAGAATGCTCGAGCATTCTTGCCATCCAGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-477s21c1
Sequence:CCGGAGCAGCGTGGGTTCCTATTTCCTCGAGGAAATAGGAACCCACGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-307s1c1
Sequence:CCGGGTCATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-939s1c1
Sequence:CCGGCCGCAAGTTCTTCCAGGACATCTCGAGATGTCCTGGAAGAACTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-585s1c1
Sequence:CCGGCCGCGAGATGATCGAGGAGATCTCGAGATCTCCTCGATCATCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-1128s1c1
Sequence:CCGGCGGCGATGGTACTGTGAACTTCTCGAGAAGTTCACAGTACCATCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-411s1c1
Sequence:CCGGGAAGACCTTCTCACTGGAGTTCTCGAGAACTCCAGTGAGAAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012320
VALIDATED
PLA2G15 MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group XV
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-288s21c1
Sequence:CCGGACCGAAAGCTACTTCACAATCCTCGAGGATTGTGAAGTAGCTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-1529s21c1
Sequence:CCGGGGACACTGGATGGCAAGAATGCTCGAGCATTCTTGCCATCCAGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-477s21c1
Sequence:CCGGAGCAGCGTGGGTTCCTATTTCCTCGAGGAAATAGGAACCCACGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-307s1c1
Sequence:CCGGGTCATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-939s1c1
Sequence:CCGGCCGCAAGTTCTTCCAGGACATCTCGAGATGTCCTGGAAGAACTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-585s1c1
Sequence:CCGGCCGCGAGATGATCGAGGAGATCTCGAGATCTCCTCGATCATCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-1128s1c1
Sequence:CCGGCGGCGATGGTACTGTGAACTTCTCGAGAAGTTCACAGTACCATCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-411s1c1
Sequence:CCGGGAAGACCTTCTCACTGGAGTTCTCGAGAACTCCAGTGAGAAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012320
VALIDATED
PLA2G15 MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group XV
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-288s21c1
Sequence:CCGGACCGAAAGCTACTTCACAATCCTCGAGGATTGTGAAGTAGCTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-1529s21c1
Sequence:CCGGGGACACTGGATGGCAAGAATGCTCGAGCATTCTTGCCATCCAGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012320.3-477s21c1
Sequence:CCGGAGCAGCGTGGGTTCCTATTTCCTCGAGGAAATAGGAACCCACGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-307s1c1
Sequence:CCGGGTCATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-939s1c1
Sequence:CCGGCCGCAAGTTCTTCCAGGACATCTCGAGATGTCCTGGAAGAACTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-585s1c1
Sequence:CCGGCCGCGAGATGATCGAGGAGATCTCGAGATCTCCTCGATCATCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-1128s1c1
Sequence:CCGGCGGCGATGGTACTGTGAACTTCTCGAGAAGTTCACAGTACCATCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012320.2-411s1c1
Sequence:CCGGGAAGACCTTCTCACTGGAGTTCTCGAGAACTCCAGTGAGAAGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133792
VALIDATED
PLA2G15 MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group XV
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-1099s21c1
Sequence:CCGGCACGCCAAACTCTTTCTACTACTCGAGTAGTAGAAAGAGTTTGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133792.2-1411s21c1
Sequence:CCGGGCAGAGTTTGTGACCATCATTCTCGAGAATGATGGTCACAAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-341s21c1
Sequence:CCGGGTTATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-1225s21c1
Sequence:CCGGGCACAGAGTATCATTGCAGGACTCGAGTCCTGCAATGATACTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1411s1c1
Sequence:CCGGGCAGAGTTTGTGACCATCATTCTCGAGAATGATGGTCACAAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133792.2-341s1c1
Sequence:CCGGGTTATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1099s1c1
Sequence:CCGGCACGCCAAACTCTTTCTACTACTCGAGTAGTAGAAAGAGTTTGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133792.2-632s1c1
Sequence:CCGGGAGGAGATGTACCAGATGTATCTCGAGATACATCTGGTACATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1225s1c1
Sequence:CCGGGCACAGAGTATCATTGCAGGACTCGAGTCCTGCAATGATACTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133792
VALIDATED
PLA2G15 MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group XV
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-1099s21c1
Sequence:CCGGCACGCCAAACTCTTTCTACTACTCGAGTAGTAGAAAGAGTTTGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133792.2-1411s21c1
Sequence:CCGGGCAGAGTTTGTGACCATCATTCTCGAGAATGATGGTCACAAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-341s21c1
Sequence:CCGGGTTATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-1225s21c1
Sequence:CCGGGCACAGAGTATCATTGCAGGACTCGAGTCCTGCAATGATACTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1411s1c1
Sequence:CCGGGCAGAGTTTGTGACCATCATTCTCGAGAATGATGGTCACAAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133792.2-341s1c1
Sequence:CCGGGTTATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1099s1c1
Sequence:CCGGCACGCCAAACTCTTTCTACTACTCGAGTAGTAGAAAGAGTTTGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133792.2-632s1c1
Sequence:CCGGGAGGAGATGTACCAGATGTATCTCGAGATACATCTGGTACATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1225s1c1
Sequence:CCGGGCACAGAGTATCATTGCAGGACTCGAGTCCTGCAATGATACTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133792
VALIDATED
PLA2G15 MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group XV
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-1099s21c1
Sequence:CCGGCACGCCAAACTCTTTCTACTACTCGAGTAGTAGAAAGAGTTTGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133792.2-1411s21c1
Sequence:CCGGGCAGAGTTTGTGACCATCATTCTCGAGAATGATGGTCACAAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-341s21c1
Sequence:CCGGGTTATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133792.2-1225s21c1
Sequence:CCGGGCACAGAGTATCATTGCAGGACTCGAGTCCTGCAATGATACTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1411s1c1
Sequence:CCGGGCAGAGTTTGTGACCATCATTCTCGAGAATGATGGTCACAAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133792.2-341s1c1
Sequence:CCGGGTTATCATTGACTGCTGGATTCTCGAGAATCCAGCAGTCAATGATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1099s1c1
Sequence:CCGGCACGCCAAACTCTTTCTACTACTCGAGTAGTAGAAAGAGTTTGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133792.2-632s1c1
Sequence:CCGGGAGGAGATGTACCAGATGTATCTCGAGATACATCTGGTACATCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133792.2-1225s1c1
Sequence:CCGGGCACAGAGTATCATTGCAGGACTCGAGTCCTGCAATGATACTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)