EMAIL THIS PAGE TO A FRIEND

PLA2G1B

phospholipase A2, group IB (pancreas)

67 Gene Product Result for
Synonyms: PLA2 PLA2A PPLA2
UniProtKB ID: P04054, B2R4H5, Q3KPI1
Gene ID:
Human(5319) Summary: Phospholipase A2 (EC 3.1.1.4) catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic PLA2 enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of PLA2 have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets (Seilhamer et al., 1986 [PubMed 3028739]
Mouse(18778) phospholipase A2, group IB, pancreas
Rat(29526) phospholipase A2, group IB, pancreas
cow(282457) phospholipase A2, group IB (pancreas)
sheep(101117700) phospholipase A2, group IB (pancreas)
domestic guinea pig(100732984) phospholipase A2, group IB (pancreas)
naked mole-rat(101699902) phospholipase A2, group IB (pancreas)
Zebrafish(571738) phospholipase A2, group IB (pancreas)
chicken(770292) phospholipase A2, group IB (pancreas)
chicken(416980) phospholipase A2, group IB (pancreas)
domestic cat(101095522) phospholipase A2, group IB (pancreas)
dog(404011) phospholipase A2, group IB (pancreas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048901 MISSION® esiRNA esiRNA targeting mouse Pla2g1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000928 Rosetta Predictions human pricing
NM_031585 Rosetta Predictions rat pricing
NM_011107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196120 predicted 293
2 SASI_Hs01_00196121 predicted 268
3 SASI_Hs02_00303516 predicted 341
4 SASI_Hs02_00303517 predicted 341
5 SASI_Hs01_00196122 predicted 327
6 SASI_Hs01_00196123 predicted 303
7 SASI_Hs01_00196124 predicted 215
8 SASI_Hs01_00196125 predicted 308
9 SASI_Hs01_00196126 predicted 298
10 SASI_Hs01_00196127 predicted 220
11 SASI_Hs01_00196128 predicted 265
12 SASI_Hs01_00196129 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264851 predicted 239
2 SASI_Rn02_00264852 predicted 234
3 SASI_Rn01_00078994 predicted 275
4 SASI_Rn01_00078995 predicted 285
5 SASI_Rn02_00264853 predicted 207
6 SASI_Rn01_00078996 predicted 253
7 SASI_Rn01_00078999 predicted 315
8 SASI_Rn01_00079000 predicted 281
9 SASI_Rn02_00264854 predicted 215
10 SASI_Rn01_00079003 predicted 214
11 SASI_Rn01_00078997 predicted 287
12 SASI_Rn01_00078998 predicted 253
13 SASI_Rn01_00079001 predicted 300
14 SASI_Rn01_00079002 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319921 predicted 205
2 SASI_Mm01_00093564 predicted 259
3 SASI_Mm01_00093565 predicted 252
4 SASI_Mm01_00093566 predicted 262
5 SASI_Mm01_00093567 predicted 290
6 SASI_Mm02_00319922 predicted 209
7 SASI_Mm02_00319923 predicted 208
8 SASI_Mm01_00093569 predicted 222
9 SASI_Mm02_00319924 predicted 209
10 SASI_Mm01_00093571 predicted 253
11 SASI_Mm01_00093562 predicted 250
12 SASI_Mm01_00093563 predicted 329
13 SASI_Mm01_00093568 predicted 260
14 SASI_Mm01_00093570 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000928
PLA2G1B MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IB (pancreas)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-369s21c1
Sequence:CCGGAGAGTGTGAGGCCTTCATTTGCTCGAGCAAATGAAGGCCTCACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-212s21c1
Sequence:CCGGCCGTGGATGAACTGGACAAGTCTCGAGACTTGTCCAGTTCATCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-239s21c1
Sequence:CCGGAGACACATGACAACTGCTATGCTCGAGCATAGCAGTTGTCATGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-311s1c1
Sequence:CCGGCCCACACCTATTCATACTCGTCTCGAGACGAGTATGAATAGGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-156s1c1
Sequence:CCGGCTTCTTGGAATACAACAACTACTCGAGTAGTTGTTGTATTCCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-429s1c1
Sequence:CCGGTCCATATAACAAGGCACACAACTCGAGTTGTGTGCCTTGTTATATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-343s1c1
Sequence:CCGGGCAATCACCTGTAGCAGCAAACTCGAGTTTGCTGCTACAGGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-273s1c1
Sequence:CCGGGCTGGACAGCTGTAAATTTCTCTCGAGAGAAATTTACAGCTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000928
PLA2G1B MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IB (pancreas)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-369s21c1
Sequence:CCGGAGAGTGTGAGGCCTTCATTTGCTCGAGCAAATGAAGGCCTCACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-212s21c1
Sequence:CCGGCCGTGGATGAACTGGACAAGTCTCGAGACTTGTCCAGTTCATCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-239s21c1
Sequence:CCGGAGACACATGACAACTGCTATGCTCGAGCATAGCAGTTGTCATGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-311s1c1
Sequence:CCGGCCCACACCTATTCATACTCGTCTCGAGACGAGTATGAATAGGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-156s1c1
Sequence:CCGGCTTCTTGGAATACAACAACTACTCGAGTAGTTGTTGTATTCCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-429s1c1
Sequence:CCGGTCCATATAACAAGGCACACAACTCGAGTTGTGTGCCTTGTTATATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-343s1c1
Sequence:CCGGGCAATCACCTGTAGCAGCAAACTCGAGTTTGCTGCTACAGGTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-273s1c1
Sequence:CCGGGCTGGACAGCTGTAAATTTCTCTCGAGAGAAATTTACAGCTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000928
PLA2G1B MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IB (pancreas)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-369s21c1
Sequence:CCGGAGAGTGTGAGGCCTTCATTTGCTCGAGCAAATGAAGGCCTCACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-212s21c1
Sequence:CCGGCCGTGGATGAACTGGACAAGTCTCGAGACTTGTCCAGTTCATCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000928.2-239s21c1
Sequence:CCGGAGACACATGACAACTGCTATGCTCGAGCATAGCAGTTGTCATGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-311s1c1
Sequence:CCGGCCCACACCTATTCATACTCGTCTCGAGACGAGTATGAATAGGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-156s1c1
Sequence:CCGGCTTCTTGGAATACAACAACTACTCGAGTAGTTGTTGTATTCCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-429s1c1
Sequence:CCGGTCCATATAACAAGGCACACAACTCGAGTTGTGTGCCTTGTTATATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-343s1c1
Sequence:CCGGGCAATCACCTGTAGCAGCAAACTCGAGTTTGCTGCTACAGGTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000928.2-273s1c1
Sequence:CCGGGCTGGACAGCTGTAAATTTCTCTCGAGAGAAATTTACAGCTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011107
PLA2G1B MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IB (pancreas)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-296s1c1
Sequence:CCGGCCAACACTTACTCCTACTCATCTCGAGATGAGTAGGAGTAAGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-142s1c1
Sequence:CCGGCTGAAGGATTACAACAACTATCTCGAGATAGTTGTTGTAATCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-258s1c1
Sequence:CCGGGCTGGAAAGCTGTAAATTCCTCTCGAGAGGAATTTACAGCTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-93s1c1
Sequence:CCGGGTGGCAGTTCCGCAATATGATCTCGAGATCATATTGCGGAACTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-262s1c1
Sequence:CCGGGAAAGCTGTAAATTCCTCATACTCGAGTATGAGGAATTTACAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011107
PLA2G1B MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IB (pancreas)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-296s1c1
Sequence:CCGGCCAACACTTACTCCTACTCATCTCGAGATGAGTAGGAGTAAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-142s1c1
Sequence:CCGGCTGAAGGATTACAACAACTATCTCGAGATAGTTGTTGTAATCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-258s1c1
Sequence:CCGGGCTGGAAAGCTGTAAATTCCTCTCGAGAGGAATTTACAGCTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-93s1c1
Sequence:CCGGGTGGCAGTTCCGCAATATGATCTCGAGATCATATTGCGGAACTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-262s1c1
Sequence:CCGGGAAAGCTGTAAATTCCTCATACTCGAGTATGAGGAATTTACAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011107
PLA2G1B MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IB (pancreas)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-296s1c1
Sequence:CCGGCCAACACTTACTCCTACTCATCTCGAGATGAGTAGGAGTAAGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-142s1c1
Sequence:CCGGCTGAAGGATTACAACAACTATCTCGAGATAGTTGTTGTAATCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-258s1c1
Sequence:CCGGGCTGGAAAGCTGTAAATTCCTCTCGAGAGGAATTTACAGCTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-93s1c1
Sequence:CCGGGTGGCAGTTCCGCAATATGATCTCGAGATCATATTGCGGAACTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011107.1-262s1c1
Sequence:CCGGGAAAGCTGTAAATTCCTCATACTCGAGTATGAGGAATTTACAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)