EMAIL THIS PAGE TO A FRIEND

PLA2G2F

phospholipase A2, group IIF

49 Gene Product Result for
UniProtKB ID: Q9BZM2, Q5R385, Q8N217, Q9H506
Gene ID:
Mouse(26971) phospholipase A2, group IIF
Rat(690388) phospholipase A2, group IIF
domestic cat(101091884) phospholipase A2, group IIF
dog(487397) phospholipase A2, group IIF
domestic guinea pig(100727867) phospholipase A2, group IIF
naked mole-rat(101726523) phospholipase A2, group IIF
cow(541294) phospholipase A2, group IIF
sheep(101106664) phospholipase A2, group IIF
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019311 MISSION® esiRNA esiRNA targeting human PLA2G2F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022819 Rosetta Predictions human pricing
NM_001109587 Rosetta Predictions rat pricing
NM_012045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058801 predicted 611
2 SASI_Hs01_00058802 predicted 1074
3 SASI_Hs01_00058803 predicted 1038
4 SASI_Hs01_00058805 predicted 431
5 SASI_Hs02_00356119 predicted 287
6 SASI_Hs01_00058806 predicted 726
7 SASI_Hs01_00058807 predicted 542
8 SASI_Hs01_00058808 predicted 502
9 SASI_Hs02_00356120 predicted 1165
10 SASI_Hs01_00058809 predicted 556
11 SASI_Hs01_00058804 predicted 1174
12 SASI_Hs01_00058810 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249851 predicted 543
2 SASI_Rn02_00249852 predicted 841
3 SASI_Rn02_00249853 predicted 603
4 SASI_Rn02_00249854 predicted 1031
5 SASI_Rn02_00249855 predicted 751
6 SASI_Rn02_00249856 predicted 347
7 SASI_Rn02_00249857 predicted 1066
8 SASI_Rn02_00249858 predicted 712
9 SASI_Rn02_00249859 predicted 615
10 SASI_Rn02_00249860 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097612 predicted 245
2 SASI_Mm01_00097613 predicted 585
3 SASI_Mm01_00097614 predicted 335
4 SASI_Mm01_00097615 predicted 615
5 SASI_Mm01_00097616 predicted 743
6 SASI_Mm01_00097618 predicted 594
7 SASI_Mm01_00097619 predicted 225
8 SASI_Mm01_00097620 predicted 584
9 SASI_Mm02_00322012 predicted 501
10 SASI_Mm01_00097621 predicted 1176
11 SASI_Mm01_00097617 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012045
PLA2G2F MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IIF
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012045.2-2124s1c1
Sequence:CCGGCCTTGTGATCTTCCTCATTTACTCGAGTAAATGAGGAAGATCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-236s1c1
Sequence:CCGGCTGGGTATGAAGAAATTCTTTCTCGAGAAAGAATTTCTTCATACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-234s1c1
Sequence:CCGGGCCTGGGTATGAAGAAATTCTCTCGAGAGAATTTCTTCATACCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-508s1c1
Sequence:CCGGGATCGAGAATGGCACCATGATCTCGAGATCATGGTGCCATTCTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-439s1c1
Sequence:CCGGCCACGACTGTTGCTATGAGAACTCGAGTTCTCATAGCAACAGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012045
PLA2G2F MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IIF
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012045.2-2124s1c1
Sequence:CCGGCCTTGTGATCTTCCTCATTTACTCGAGTAAATGAGGAAGATCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-236s1c1
Sequence:CCGGCTGGGTATGAAGAAATTCTTTCTCGAGAAAGAATTTCTTCATACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-234s1c1
Sequence:CCGGGCCTGGGTATGAAGAAATTCTCTCGAGAGAATTTCTTCATACCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-508s1c1
Sequence:CCGGGATCGAGAATGGCACCATGATCTCGAGATCATGGTGCCATTCTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-439s1c1
Sequence:CCGGCCACGACTGTTGCTATGAGAACTCGAGTTCTCATAGCAACAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012045
PLA2G2F MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IIF
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012045.2-2124s1c1
Sequence:CCGGCCTTGTGATCTTCCTCATTTACTCGAGTAAATGAGGAAGATCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-236s1c1
Sequence:CCGGCTGGGTATGAAGAAATTCTTTCTCGAGAAAGAATTTCTTCATACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-234s1c1
Sequence:CCGGGCCTGGGTATGAAGAAATTCTCTCGAGAGAATTTCTTCATACCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-508s1c1
Sequence:CCGGGATCGAGAATGGCACCATGATCTCGAGATCATGGTGCCATTCTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012045.2-439s1c1
Sequence:CCGGCCACGACTGTTGCTATGAGAACTCGAGTTCTCATAGCAACAGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022819
PLA2G2F MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IIF
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-327s1c1
Sequence:CCGGGACATGCATGTGTGACAAGAACTCGAGTTCTTGTCACACATGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-298s1c1
Sequence:CCGGGACCTCAACAAGACAGAGTGTCTCGAGACACTCTGTCTTGTTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-93s1c1
Sequence:CCGGCGTCACAGGGAGGAGCGCCATCTCGAGATGGCGCTCCTCCCTGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-205s1c1
Sequence:CCGGTGCTGCTACCAGGAACTCTTTCTCGAGAAAGAGTTCCTGGTAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-267s1c1
Sequence:CCGGCATCGAGAACAACACTGAGATCTCGAGATCTCAGTGTTGTTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022819
PLA2G2F MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IIF
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-327s1c1
Sequence:CCGGGACATGCATGTGTGACAAGAACTCGAGTTCTTGTCACACATGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-298s1c1
Sequence:CCGGGACCTCAACAAGACAGAGTGTCTCGAGACACTCTGTCTTGTTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-93s1c1
Sequence:CCGGCGTCACAGGGAGGAGCGCCATCTCGAGATGGCGCTCCTCCCTGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-205s1c1
Sequence:CCGGTGCTGCTACCAGGAACTCTTTCTCGAGAAAGAGTTCCTGGTAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-267s1c1
Sequence:CCGGCATCGAGAACAACACTGAGATCTCGAGATCTCAGTGTTGTTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022819
PLA2G2F MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IIF
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-327s1c1
Sequence:CCGGGACATGCATGTGTGACAAGAACTCGAGTTCTTGTCACACATGCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-298s1c1
Sequence:CCGGGACCTCAACAAGACAGAGTGTCTCGAGACACTCTGTCTTGTTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-93s1c1
Sequence:CCGGCGTCACAGGGAGGAGCGCCATCTCGAGATGGCGCTCCTCCCTGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-205s1c1
Sequence:CCGGTGCTGCTACCAGGAACTCTTTCTCGAGAAAGAGTTCCTGGTAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022819.1-267s1c1
Sequence:CCGGCATCGAGAACAACACTGAGATCTCGAGATCTCAGTGTTGTTCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)