EMAIL THIS PAGE TO A FRIEND

PLA2G4A

phospholipase A2, group IVA (cytosolic, calcium-dependent)

75 Gene Product Result for
Synonyms: PLA2G4 cPLA2-alpha
UniProtKB ID: P47712, B1AKG4, Q29R80
Gene ID:
Human(5321) Summary: This gene encodes a member of the cytosolic phospholipase A2 group IV family. The enzyme catalyzes the hydrolysis of membrane phospholipids to release arachidonic acid which is subsequently metabolized into eicosanoids. Eicosanoids, including prostaglandins and leukotrienes, are lipid-based cellular hormones that regulate hemodynamics, inflammatory responses, and other intracellular pathways. The hydrolysis reaction also produces lysophospholipids that are converted into platelet-activating factor. The enzyme is activated by increased intracellular Ca(2+) levels and phosphorylation, resulting in its translocation from the cytosol and nucleus to perinuclear membrane vesicles. [provided by RefSeq, Jul 2008]
Mouse(18783) phospholipase A2, group IVA (cytosolic, calcium-dependent)
Rat(24653) phospholipase A2, group IVA (cytosolic, calcium-dependent)
Zebrafish(559087) phospholipase A2, group IVA (cytosolic, calcium-dependent)
chicken(396394) phospholipase A2, group IVA (cytosolic, calcium-dependent)
dog(480048) phospholipase A2, group IVA (cytosolic, calcium-dependent)
Horse(100033889) phospholipase A2, group IVA (cytosolic, calcium-dependent)
domestic cat(101082033) phospholipase A2, group IVA (cytosolic, calcium-dependent)
domestic guinea pig(100715719) phospholipase A2, group IVA (cytosolic, calcium-dependent)
naked mole-rat(101704061) phospholipase A2, group IVA (cytosolic, calcium-dependent)
cow(525072) phospholipase A2, group IVA (cytosolic, calcium-dependent)
sheep(101111472) phospholipase A2, group IVA (cytosolic, calcium-dependent)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024420 Rosetta Predictions human pricing
NM_133551 Rosetta Predictions rat pricing
NM_008869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356732 predicted 398
2 SASI_Hs02_00356733 predicted 1557
3 SASI_Hs01_00104709 predicted 1583
4 SASI_Hs02_00356734 predicted 238
5 SASI_Hs02_00356735 predicted 1723
6 SASI_Hs01_00104710 predicted 2440
7 SASI_Hs01_00104711 predicted 468
8 SASI_Hs01_00104713 predicted 2280
9 SASI_Hs01_00104715 predicted 822
10 SASI_Hs01_00104716 predicted 1259
11 SASI_Hs01_00104708 predicted 1382
12 SASI_Hs01_00104712 predicted 2007
13 SASI_Hs01_00104714 predicted 585
14 SASI_Hs01_00104717 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267738 predicted 2056
2 SASI_Rn01_00058148 predicted 216
3 SASI_Rn01_00058149 predicted 1413
4 SASI_Rn01_00058150 predicted 341
5 SASI_Rn01_00058151 predicted 1443
6 SASI_Rn01_00058152 predicted 2352
7 SASI_Rn02_00267739 predicted 788
8 SASI_Rn01_00058154 predicted 205
9 SASI_Rn01_00058156 predicted 800
10 SASI_Rn01_00058157 predicted 702
11 SASI_Rn01_00058153 predicted 1515
12 SASI_Rn01_00058155 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314844 predicted 2048
2 SASI_Mm02_00314845 predicted 1404
3 SASI_Mm02_00314846 predicted 562
4 SASI_Mm02_00314847 predicted 957
5 SASI_Mm02_00314848 predicted 334
6 SASI_Mm02_00314849 predicted 2329
7 SASI_Mm02_00314850 predicted 1043
8 SASI_Mm02_00314851 predicted 194
9 SASI_Mm02_00314852 predicted 1541
10 SASI_Mm02_00314853 predicted 2253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008869
VALIDATED
PLA2G4A MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-1990s21c1
Sequence:CCGGGTTTGATCGGGAAGGATTAAACTCGAGTTTAATCCTTCCCGATCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-468s21c1
Sequence:CCGGGCACAGCTACATTCCCTGTATCTCGAGATACAGGGAATGTAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-2415s21c1
Sequence:CCGGGCTGGGATGATCAAGCCATTTCTCGAGAAATGGCTTGATCATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-1092s21c1
Sequence:CCGGCCCTGAGTAGTTTGAAGGAAACTCGAGTTTCCTTCAAACTACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-2415s1c1
Sequence:CCGGGCTGGGATGATCAAGCCATTTCTCGAGAAATGGCTTGATCATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-1092s1c1
Sequence:CCGGCCCTGAGTAGTTTGAAGGAAACTCGAGTTTCCTTCAAACTACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-1728s1c1
Sequence:CCGGCGGTAGCAGATCCAGATGAATCTCGAGATTCATCTGGATCTGCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008869.2-1811s1c1
Sequence:CCGGCTCACATTTAACCTGCCGTATCTCGAGATACGGCAGGTTAAATGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-468s1c1
Sequence:CCGGGCACAGCTACATTCCCTGTATCTCGAGATACAGGGAATGTAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008869
VALIDATED
PLA2G4A MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-1990s21c1
Sequence:CCGGGTTTGATCGGGAAGGATTAAACTCGAGTTTAATCCTTCCCGATCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-468s21c1
Sequence:CCGGGCACAGCTACATTCCCTGTATCTCGAGATACAGGGAATGTAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-2415s21c1
Sequence:CCGGGCTGGGATGATCAAGCCATTTCTCGAGAAATGGCTTGATCATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-1092s21c1
Sequence:CCGGCCCTGAGTAGTTTGAAGGAAACTCGAGTTTCCTTCAAACTACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-2415s1c1
Sequence:CCGGGCTGGGATGATCAAGCCATTTCTCGAGAAATGGCTTGATCATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-1092s1c1
Sequence:CCGGCCCTGAGTAGTTTGAAGGAAACTCGAGTTTCCTTCAAACTACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-1728s1c1
Sequence:CCGGCGGTAGCAGATCCAGATGAATCTCGAGATTCATCTGGATCTGCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008869.2-1811s1c1
Sequence:CCGGCTCACATTTAACCTGCCGTATCTCGAGATACGGCAGGTTAAATGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-468s1c1
Sequence:CCGGGCACAGCTACATTCCCTGTATCTCGAGATACAGGGAATGTAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008869
VALIDATED
PLA2G4A MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-1990s21c1
Sequence:CCGGGTTTGATCGGGAAGGATTAAACTCGAGTTTAATCCTTCCCGATCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-468s21c1
Sequence:CCGGGCACAGCTACATTCCCTGTATCTCGAGATACAGGGAATGTAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-2415s21c1
Sequence:CCGGGCTGGGATGATCAAGCCATTTCTCGAGAAATGGCTTGATCATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008869.3-1092s21c1
Sequence:CCGGCCCTGAGTAGTTTGAAGGAAACTCGAGTTTCCTTCAAACTACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-2415s1c1
Sequence:CCGGGCTGGGATGATCAAGCCATTTCTCGAGAAATGGCTTGATCATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-1092s1c1
Sequence:CCGGCCCTGAGTAGTTTGAAGGAAACTCGAGTTTCCTTCAAACTACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-1728s1c1
Sequence:CCGGCGGTAGCAGATCCAGATGAATCTCGAGATTCATCTGGATCTGCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008869.2-1811s1c1
Sequence:CCGGCTCACATTTAACCTGCCGTATCTCGAGATACGGCAGGTTAAATGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008869.2-468s1c1
Sequence:CCGGGCACAGCTACATTCCCTGTATCTCGAGATACAGGGAATGTAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024420
VALIDATED
PLA2G4A MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-912s21c1
Sequence:CCGGCCTTGTATTCTCACCCTGATTCTCGAGAATCAGGGTGAGAATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1958s21c1
Sequence:CCGGCCTCCGTTCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGAACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-2688s21c1
Sequence:CCGGTGATACAAATGTAGGGATATACTCGAGTATATCCCTACATTTGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1789s21c1
Sequence:CCGGTGATGAATTTGAGCGAATATACTCGAGTATATTCGCTCAAATTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1299s21c1
Sequence:CCGGCCGACTTATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-845s1c1
Sequence:CCGGCCTTGTATTCTCACCCTGATTCTCGAGAATCAGGGTGAGAATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-1891s1c1
Sequence:CCGGCCTCCGTTCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGAACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-2324s1c1
Sequence:CCGGCCCTTAGTAATGTTGAGGCAACTCGAGTTGCCTCAACATTACTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-418s1c1
Sequence:CCGGGCCAATTATGTCATGGATGAACTCGAGTTCATCCATGACATAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-1232s1c1
Sequence:CCGGCCGACTTATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024420
VALIDATED
PLA2G4A MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-912s21c1
Sequence:CCGGCCTTGTATTCTCACCCTGATTCTCGAGAATCAGGGTGAGAATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1958s21c1
Sequence:CCGGCCTCCGTTCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGAACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-2688s21c1
Sequence:CCGGTGATACAAATGTAGGGATATACTCGAGTATATCCCTACATTTGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1789s21c1
Sequence:CCGGTGATGAATTTGAGCGAATATACTCGAGTATATTCGCTCAAATTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1299s21c1
Sequence:CCGGCCGACTTATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-845s1c1
Sequence:CCGGCCTTGTATTCTCACCCTGATTCTCGAGAATCAGGGTGAGAATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-1891s1c1
Sequence:CCGGCCTCCGTTCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGAACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-2324s1c1
Sequence:CCGGCCCTTAGTAATGTTGAGGCAACTCGAGTTGCCTCAACATTACTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-418s1c1
Sequence:CCGGGCCAATTATGTCATGGATGAACTCGAGTTCATCCATGACATAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-1232s1c1
Sequence:CCGGCCGACTTATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024420
VALIDATED
PLA2G4A MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-912s21c1
Sequence:CCGGCCTTGTATTCTCACCCTGATTCTCGAGAATCAGGGTGAGAATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1958s21c1
Sequence:CCGGCCTCCGTTCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGAACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-2688s21c1
Sequence:CCGGTGATACAAATGTAGGGATATACTCGAGTATATCCCTACATTTGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1789s21c1
Sequence:CCGGTGATGAATTTGAGCGAATATACTCGAGTATATTCGCTCAAATTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024420.2-1299s21c1
Sequence:CCGGCCGACTTATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-845s1c1
Sequence:CCGGCCTTGTATTCTCACCCTGATTCTCGAGAATCAGGGTGAGAATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-1891s1c1
Sequence:CCGGCCTCCGTTCAAGGAACTTCTACTCGAGTAGAAGTTCCTTGAACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-2324s1c1
Sequence:CCGGCCCTTAGTAATGTTGAGGCAACTCGAGTTGCCTCAACATTACTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-418s1c1
Sequence:CCGGGCCAATTATGTCATGGATGAACTCGAGTTCATCCATGACATAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024420.1-1232s1c1
Sequence:CCGGCCGACTTATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)