EMAIL THIS PAGE TO A FRIEND

PLA2G4B

phospholipase A2, group IVB (cytosolic)

136 Gene Product Result for
Synonyms: HsT16992 cPLA2-beta
Gene ID:
Human(100137049) Summary: This gene encodes a member of the cytosolic phospholipase A2 protein family. Phospholipase A2 enzymes hydrolyze the sn-2 bond of phospholipids, releasing lysophospholipids and fatty acids. This enzyme may be associated with mitochondria and early endosomes. Most tissues also express read-through transcripts from the upstream gene into this gene, some of which may encode fusion proteins combining the N-terminus of the upstream gene including its JmjC domain with the almost complete coding region of this gene, including the C2 and cytoplasmic phospholipase A2 domains. [provided by RefSeq, Jul 2008]
Mouse(211429) phospholipase A2, group IVB (cytosolic)
Rat(311341) phospholipase A2, group IVB (cytosolic)
cow(505485) phospholipase A2, group IVB (cytosolic)
sheep(101115372) phospholipase A2, group IVB (cytosolic)
naked mole-rat(101703792) phospholipase A2, group IVB (cytosolic)
Domestic Rabbit(100533118) phospholipase A2, group IVB (cytosolic)
domestic guinea pig(100734001) phospholipase A2, group IVB (cytosolic)
chicken(101749229) phospholipase A2, group IVB (cytosolic)
Horse(100071062) phospholipase A2, group IVB (cytosolic)
domestic cat(101083342) phospholipase A2, group IVB (cytosolic)
dog(487512) phospholipase A2, group IVB (cytosolic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301621 ANTI-PLA2G4B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114633 Rosetta Predictions human pricing
NM_001107764 Rosetta Predictions rat pricing
NM_145378 Rosetta Predictions mouse pricing
XM_355378 Rosetta Predictions mouse pricing
XM_892847 Rosetta Predictions mouse pricing
XM_900371 Rosetta Predictions mouse pricing
XM_900375 Rosetta Predictions mouse pricing
XM_900391 Rosetta Predictions mouse pricing
XM_900400 Rosetta Predictions mouse pricing
XM_900408 Rosetta Predictions mouse pricing
XM_900416 Rosetta Predictions mouse pricing
XM_900430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326714 predicted 1738
2 SASI_Hs02_00326715 predicted 1615
3 SASI_Hs02_00326716 predicted 1066
4 SASI_Hs02_00326717 predicted 305
5 SASI_Hs02_00326718 predicted 1520
6 SASI_Hs02_00326719 predicted 733
7 SASI_Hs02_00326720 predicted 1740
8 SASI_Hs02_00326721 predicted 768
9 SASI_Hs02_00326722 predicted 585
10 SASI_Hs02_00326723 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232035 predicted 643
2 SASI_Rn02_00232036 predicted 640
3 SASI_Rn02_00232037 predicted 1791
4 SASI_Rn02_00232038 predicted 1932
5 SASI_Rn02_00232039 predicted 2328
6 SASI_Rn02_00232040 predicted 965
7 SASI_Rn02_00232041 predicted 1107
8 SASI_Rn02_00232042 predicted 791
9 SASI_Rn02_00232043 predicted 2327
10 SASI_Rn02_00232044 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340679 predicted 640
2 SASI_Mm02_00340680 predicted 963
3 SASI_Mm02_00340681 predicted 2327
4 SASI_Mm02_00340682 predicted 2404
5 SASI_Mm02_00340683 predicted 1275
6 SASI_Mm02_00340684 predicted 357
7 SASI_Mm02_00340685 predicted 1381
8 SASI_Mm02_00340686 predicted 1921
9 SASI_Mm02_00340687 predicted 928
10 SASI_Mm02_00340688 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217124 predicted 4315
2 SASI_Mm01_00217125 predicted 3978
3 SASI_Mm01_00217126 predicted 3985
4 SASI_Mm01_00217127 predicted 4057
5 SASI_Mm01_00217128 predicted 3646
6 SASI_Mm01_00217129 predicted 2931
7 SASI_Mm01_00217130 predicted 3035
8 SASI_Mm01_00217131 predicted 3585
9 SASI_Mm01_00217132 predicted 4060
10 SASI_Mm01_00217133 predicted 2930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266702 predicted 667
2 SASI_Mm01_00266703 predicted 1281
3 SASI_Mm01_00266704 predicted 1605
4 SASI_Mm01_00266705 predicted 2962
5 SASI_Mm01_00266706 predicted 3042
6 SASI_Mm01_00266707 predicted 574
7 SASI_Mm01_00266708 predicted 803
8 SASI_Mm01_00266709 predicted 2015
9 SASI_Mm01_00266710 predicted 802
10 SASI_Mm01_00266711 predicted 2558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254024 predicted 672
2 SASI_Mm01_00254025 predicted 636
3 SASI_Mm01_00254026 predicted 645
4 SASI_Mm01_00254027 predicted 679
5 SASI_Mm01_00254028 predicted 605
6 SASI_Mm01_00254029 predicted 636
7 SASI_Mm01_00254030 predicted 585
8 SASI_Mm01_00254031 predicted 600
9 SASI_Mm01_00254032 predicted 733
10 SASI_Mm01_00254033 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208761 predicted 283
2 SASI_Mm01_00208762 predicted 277
3 SASI_Mm01_00208763 predicted 361
4 SASI_Mm01_00208764 predicted 456
5 SASI_Mm01_00208765 predicted 226
6 SASI_Mm01_00208766 predicted 341
7 SASI_Mm01_00208767 predicted 249
8 SASI_Mm01_00208768 predicted 409
9 SASI_Mm01_00208769 predicted 355
10 SASI_Mm01_00208770 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254454 predicted 278
2 SASI_Mm01_00254455 predicted 278
3 SASI_Mm01_00254456 predicted 354
4 SASI_Mm01_00254457 predicted 279
5 SASI_Mm01_00254458 predicted 568
6 SASI_Mm01_00254459 predicted 454
7 SASI_Mm01_00254460 predicted 546
8 SASI_Mm01_00254461 predicted 405
9 SASI_Mm01_00254462 predicted 551
10 SASI_Mm01_00254463 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222677 predicted 277
2 SASI_Mm01_00222678 predicted 275
3 SASI_Mm01_00222679 predicted 520
4 SASI_Mm01_00222680 predicted 362
5 SASI_Mm01_00222681 predicted 526
6 SASI_Mm01_00222682 predicted 462
7 SASI_Mm01_00222683 predicted 736
8 SASI_Mm01_00222684 predicted 948
9 SASI_Mm01_00222685 predicted 895
10 SASI_Mm01_00222686 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271828 predicted 447
2 SASI_Mm01_00271829 predicted 591
3 SASI_Mm01_00271830 predicted 986
4 SASI_Mm01_00271831 predicted 449
5 SASI_Mm01_00271832 predicted 1050
6 SASI_Mm01_00271833 predicted 526
7 SASI_Mm01_00271834 predicted 917
8 SASI_Mm01_00271835 predicted 1020
9 SASI_Mm01_00271836 predicted 1062
10 SASI_Mm01_00271837 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202641 predicted 2897
2 SASI_Mm01_00202642 predicted 2563
3 SASI_Mm01_00202643 predicted 2560
4 SASI_Mm01_00202644 predicted 2640
5 SASI_Mm01_00202645 predicted 2216
6 SASI_Mm01_00202646 predicted 1507
7 SASI_Mm01_00202647 predicted 1611
8 SASI_Mm01_00202648 predicted 2157
9 SASI_Mm01_00202649 predicted 2641
10 SASI_Mm01_00202650 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260642 predicted 2538
2 SASI_Mm01_00260643 predicted 2869
3 SASI_Mm01_00260644 predicted 4231
4 SASI_Mm01_00260645 predicted 4226
5 SASI_Mm01_00260646 predicted 3177
6 SASI_Mm01_00260647 predicted 3280
7 SASI_Mm01_00260648 predicted 3826
8 SASI_Mm01_00260649 predicted 4311
9 SASI_Mm01_00260650 predicted 2828
10 SASI_Mm01_00260651 predicted 3181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145378
PLA2G4B MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVB (cytosolic)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-155s21c1
Sequence:CCGGGCCTTCCAAGGACCTAGTAACCTCGAGGTTACTAGGTCCTTGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145378.3-2715s21c1
Sequence:CCGGACACTGTGACACGGAACATTTCTCGAGAAATGTTCCGTGTCACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-1818s21c1
Sequence:CCGGCATTTCCACAAGGACTATTTCCTCGAGGAAATAGTCCTTGTGGAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-1375s21c1
Sequence:CCGGAGAACCCTCTGCCTATCTATTCTCGAGAATAGATAGGCAGAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-2330s21c1
Sequence:CCGGGCTGTTACGGCTGACGCATTACTCGAGTAATGCGTCAGCCGTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145378
PLA2G4B MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVB (cytosolic)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-155s21c1
Sequence:CCGGGCCTTCCAAGGACCTAGTAACCTCGAGGTTACTAGGTCCTTGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145378.3-2715s21c1
Sequence:CCGGACACTGTGACACGGAACATTTCTCGAGAAATGTTCCGTGTCACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-1818s21c1
Sequence:CCGGCATTTCCACAAGGACTATTTCCTCGAGGAAATAGTCCTTGTGGAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-1375s21c1
Sequence:CCGGAGAACCCTCTGCCTATCTATTCTCGAGAATAGATAGGCAGAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-2330s21c1
Sequence:CCGGGCTGTTACGGCTGACGCATTACTCGAGTAATGCGTCAGCCGTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145378
PLA2G4B MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVB (cytosolic)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-155s21c1
Sequence:CCGGGCCTTCCAAGGACCTAGTAACCTCGAGGTTACTAGGTCCTTGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145378.3-2715s21c1
Sequence:CCGGACACTGTGACACGGAACATTTCTCGAGAAATGTTCCGTGTCACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-1818s21c1
Sequence:CCGGCATTTCCACAAGGACTATTTCCTCGAGGAAATAGTCCTTGTGGAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-1375s21c1
Sequence:CCGGAGAACCCTCTGCCTATCTATTCTCGAGAATAGATAGGCAGAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145378.3-2330s21c1
Sequence:CCGGGCTGTTACGGCTGACGCATTACTCGAGTAATGCGTCAGCCGTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114633
PLA2G4B MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVB (cytosolic)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-979s21c1
Sequence:CCGGAGATCCCAGTGGTAGCTATTACTCGAGTAATAGCTACCACTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114633.1-2500s21c1
Sequence:CCGGTGCAGGTGGGAACTGTCATCACTCGAGTGATGACAGTTCCCACCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-1799s21c1
Sequence:CCGGGGCCCAGGCCACACATAATTTCTCGAGAAATTATGTGTGGCCTGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-460s21c1
Sequence:CCGGGGCGCCTGGAAGTTGAATTTCCTCGAGGAAATTCAACTTCCAGGCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-1945s21c1
Sequence:CCGGATGTTGGCTACCTCATCAATACTCGAGTATTGATGAGGTAGCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114633
PLA2G4B MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVB (cytosolic)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-979s21c1
Sequence:CCGGAGATCCCAGTGGTAGCTATTACTCGAGTAATAGCTACCACTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114633.1-2500s21c1
Sequence:CCGGTGCAGGTGGGAACTGTCATCACTCGAGTGATGACAGTTCCCACCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-1799s21c1
Sequence:CCGGGGCCCAGGCCACACATAATTTCTCGAGAAATTATGTGTGGCCTGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-460s21c1
Sequence:CCGGGGCGCCTGGAAGTTGAATTTCCTCGAGGAAATTCAACTTCCAGGCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-1945s21c1
Sequence:CCGGATGTTGGCTACCTCATCAATACTCGAGTATTGATGAGGTAGCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114633
PLA2G4B MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVB (cytosolic)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-979s21c1
Sequence:CCGGAGATCCCAGTGGTAGCTATTACTCGAGTAATAGCTACCACTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114633.1-2500s21c1
Sequence:CCGGTGCAGGTGGGAACTGTCATCACTCGAGTGATGACAGTTCCCACCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-1799s21c1
Sequence:CCGGGGCCCAGGCCACACATAATTTCTCGAGAAATTATGTGTGGCCTGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-460s21c1
Sequence:CCGGGGCGCCTGGAAGTTGAATTTCCTCGAGGAAATTCAACTTCCAGGCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114633.1-1945s21c1
Sequence:CCGGATGTTGGCTACCTCATCAATACTCGAGTATTGATGAGGTAGCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)