EMAIL THIS PAGE TO A FRIEND

PLA2G4C

phospholipase A2, group IVC (cytosolic, calcium-independent)

93 Gene Product Result for
Synonyms: CPLA2-gamma
UniProtKB ID: Q9UP65, B2RB71, B4DI40, O75457, Q6IBI8, Q9UG68
Gene ID:
Human(8605) Summary: This gene encodes a protein which is a member of the phospholipase A2 enzyme family which hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids, both of which serve as precursors in the production of signaling molecules. The encoded protein has been shown to be a calcium-independent and membrane bound enzyme. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(232889) phospholipase A2, group IVC (cytosolic, calcium-independent)
Rat(691810) phospholipase A2, group IVC (cytosolic, calcium-independent)
domestic guinea pig(100733732) phospholipase A2, group IVC (cytosolic, calcium-independent)
naked mole-rat(101713091) phospholipase A2, group IVC (cytosolic, calcium-independent)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156211 MISSION® esiRNA esiRNA human PLA2G4C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003706 Rosetta Predictions human pricing
XM_001079728 Rosetta Predictions rat pricing
NM_001004762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228254 predicted 722
2 SASI_Hs01_00228255 predicted 1908
3 SASI_Hs01_00228256 predicted 1148
4 SASI_Hs01_00228258 predicted 565
5 SASI_Hs01_00228259 predicted 390
6 SASI_Hs02_00336121 predicted 581
7 SASI_Hs01_00228261 predicted 1887
8 SASI_Hs01_00228262 predicted 976
9 SASI_Hs01_00228263 predicted 746
10 SASI_Hs02_00336122 predicted 1083
11 SASI_Hs01_00228257 predicted 1833
12 SASI_Hs01_00228260 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365226 predicted 608
2 SASI_Rn02_00365227 predicted 1372
3 SASI_Rn02_00365228 predicted 1065
4 SASI_Rn02_00365229 predicted 562
5 SASI_Rn02_00365230 predicted 1020
6 SASI_Rn02_00365231 predicted 608
7 SASI_Rn02_00365232 predicted 1512
8 SASI_Rn02_00365233 predicted 753
9 SASI_Rn02_00365234 predicted 966
10 SASI_Rn02_00365235 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104449 predicted 1558
2 SASI_Mm01_00104450 predicted 514
3 SASI_Mm01_00104451 predicted 528
4 SASI_Mm01_00104452 predicted 1049
5 SASI_Mm01_00104453 predicted 203
6 SASI_Mm01_00104454 predicted 349
7 SASI_Mm01_00104455 predicted 1017
8 SASI_Mm01_00104456 predicted 346
9 SASI_Mm01_00104457 predicted 636
10 SASI_Mm01_00104458 predicted 1842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003706
PLA2G4C MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVC (cytosolic, calcium-independent)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003706.2-1778s21c1
Sequence:CCGGTGGACCAGTGGTGATGCATTTCTCGAGAAATGCATCACCACTGGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003706.2-2420s21c1
Sequence:CCGGAGTAAGAACTTGGGCTTAAATCTCGAGATTTAAGCCCAAGTTCTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-760s1c1
Sequence:CCGGCCGGAGTCTCATTTGTCCAATCTCGAGATTGGACAAATGAGACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-376s1c1
Sequence:CCGGCGAAGACTTCATGTGCTGAAACTCGAGTTTCAGCACATGAAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-616s1c1
Sequence:CCGGGCTGACCTGAAACATCGATTTCTCGAGAAATCGATGTTTCAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-1828s1c1
Sequence:CCGGGCCAAGAAGAATGTCAGGGAACTCGAGTTCCCTGACATTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-1091s1c1
Sequence:CCGGCCCTGAAAGGTTTATGGAGAACTCGAGTTCTCCATAAACCTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003706
PLA2G4C MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVC (cytosolic, calcium-independent)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003706.2-1778s21c1
Sequence:CCGGTGGACCAGTGGTGATGCATTTCTCGAGAAATGCATCACCACTGGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003706.2-2420s21c1
Sequence:CCGGAGTAAGAACTTGGGCTTAAATCTCGAGATTTAAGCCCAAGTTCTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-760s1c1
Sequence:CCGGCCGGAGTCTCATTTGTCCAATCTCGAGATTGGACAAATGAGACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-376s1c1
Sequence:CCGGCGAAGACTTCATGTGCTGAAACTCGAGTTTCAGCACATGAAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-616s1c1
Sequence:CCGGGCTGACCTGAAACATCGATTTCTCGAGAAATCGATGTTTCAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-1828s1c1
Sequence:CCGGGCCAAGAAGAATGTCAGGGAACTCGAGTTCCCTGACATTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-1091s1c1
Sequence:CCGGCCCTGAAAGGTTTATGGAGAACTCGAGTTCTCCATAAACCTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003706
PLA2G4C MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVC (cytosolic, calcium-independent)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003706.2-1778s21c1
Sequence:CCGGTGGACCAGTGGTGATGCATTTCTCGAGAAATGCATCACCACTGGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003706.2-2420s21c1
Sequence:CCGGAGTAAGAACTTGGGCTTAAATCTCGAGATTTAAGCCCAAGTTCTTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-760s1c1
Sequence:CCGGCCGGAGTCTCATTTGTCCAATCTCGAGATTGGACAAATGAGACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-376s1c1
Sequence:CCGGCGAAGACTTCATGTGCTGAAACTCGAGTTTCAGCACATGAAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-616s1c1
Sequence:CCGGGCTGACCTGAAACATCGATTTCTCGAGAAATCGATGTTTCAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-1828s1c1
Sequence:CCGGGCCAAGAAGAATGTCAGGGAACTCGAGTTCCCTGACATTCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003706.1-1091s1c1
Sequence:CCGGCCCTGAAAGGTTTATGGAGAACTCGAGTTCTCCATAAACCTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004762
PLA2G4C MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVC (cytosolic, calcium-independent)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1119s1c1
Sequence:CCGGCGCTTCAAGAAGACACAAGAACTCGAGTTCTTGTGTCTTCTTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1565s1c1
Sequence:CCGGGCACTTTACTCTGTTCAACAACTCGAGTTGTTGAACAGAGTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1370s1c1
Sequence:CCGGTGTGCGTGAAACTCACCTCATCTCGAGATGAGGTGAGTTTCACGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1846s1c1
Sequence:CCGGCCCACAACATATCTAAGGATTCTCGAGAATCCTTAGATATGTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004762.1-2154s1c1
Sequence:CCGGGCAAAGTATGTTCTTCAGATACTCGAGTATCTGAAGAACATACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004762
PLA2G4C MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVC (cytosolic, calcium-independent)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1119s1c1
Sequence:CCGGCGCTTCAAGAAGACACAAGAACTCGAGTTCTTGTGTCTTCTTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1565s1c1
Sequence:CCGGGCACTTTACTCTGTTCAACAACTCGAGTTGTTGAACAGAGTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1370s1c1
Sequence:CCGGTGTGCGTGAAACTCACCTCATCTCGAGATGAGGTGAGTTTCACGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1846s1c1
Sequence:CCGGCCCACAACATATCTAAGGATTCTCGAGAATCCTTAGATATGTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004762.1-2154s1c1
Sequence:CCGGGCAAAGTATGTTCTTCAGATACTCGAGTATCTGAAGAACATACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004762
PLA2G4C MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVC (cytosolic, calcium-independent)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1119s1c1
Sequence:CCGGCGCTTCAAGAAGACACAAGAACTCGAGTTCTTGTGTCTTCTTGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1565s1c1
Sequence:CCGGGCACTTTACTCTGTTCAACAACTCGAGTTGTTGAACAGAGTAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1370s1c1
Sequence:CCGGTGTGCGTGAAACTCACCTCATCTCGAGATGAGGTGAGTTTCACGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004762.1-1846s1c1
Sequence:CCGGCCCACAACATATCTAAGGATTCTCGAGAATCCTTAGATATGTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004762.1-2154s1c1
Sequence:CCGGGCAAAGTATGTTCTTCAGATACTCGAGTATCTGAAGAACATACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)