EMAIL THIS PAGE TO A FRIEND

PLA2G4D

phospholipase A2, group IVD (cytosolic)

47 Gene Product Result for
Synonyms: cPLA2delta
UniProtKB ID: Q86XP0, Q8N176
Gene ID:
Human(283748) Summary: The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]
Mouse(78390) phospholipase A2, group IVD
Rat(691905) phospholipase A2, group IVD (cytosolic)
cow(531209) phospholipase A2, group IVD (cytosolic)
sheep(101116150) phospholipase A2, group IVD (cytosolic)
naked mole-rat(101717491) phospholipase A2, group IVD (cytosolic)
Domestic Rabbit(100340775) phospholipase A2, group IVD (cytosolic)
domestic guinea pig(100734841) phospholipase A2, group IVD (cytosolic)
dog(608811) phospholipase A2, group IVD (cytosolic)
Horse(100071025) phospholipase A2, group IVD (cytosolic)
domestic cat(101082829) phospholipase A2, group IVD (cytosolic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178034 Rosetta Predictions human pricing
XM_001080051 Rosetta Predictions rat pricing
NM_001024137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100780 predicted 254
2 SASI_Hs01_00100781 predicted 2700
3 SASI_Hs02_00369516 predicted 942
4 SASI_Hs01_00100782 predicted 1109
5 SASI_Hs01_00100783 predicted 678
6 SASI_Hs02_00369517 predicted 360
7 SASI_Hs01_00100784 predicted 400
8 SASI_Hs01_00100785 predicted 551
9 SASI_Hs01_00100786 predicted 257
10 SASI_Hs01_00100787 predicted 1159
11 SASI_Hs01_00100788 predicted 861
12 SASI_Hs01_00100789 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366389 predicted 347
2 SASI_Rn02_00366390 predicted 273
3 SASI_Rn02_00366391 predicted 352
4 SASI_Rn02_00366392 predicted 261
5 SASI_Rn02_00366393 predicted 761
6 SASI_Rn02_00366394 predicted 368
7 SASI_Rn02_00366395 predicted 774
8 SASI_Rn02_00366396 predicted 315
9 SASI_Rn02_00366397 predicted 534
10 SASI_Rn02_00366398 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287561 predicted 2497
2 SASI_Mm01_00083476 predicted 1273
3 SASI_Mm01_00083477 predicted 600
4 SASI_Mm01_00083478 predicted 328
5 SASI_Mm01_00083479 predicted 2185
6 SASI_Mm02_00287562 predicted 1825
7 SASI_Mm01_00083481 predicted 244
8 SASI_Mm01_00083483 predicted 2433
9 SASI_Mm01_00083484 predicted 1474
10 SASI_Mm01_00083485 predicted 457
11 SASI_Mm01_00083480 predicted 2076
12 SASI_Mm01_00083482 predicted 2566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355379
PLA2G4D MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVD (cytosolic)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-412s1c1
Sequence:CCGGCGAGACCTTCAGTTTCCTCATCTCGAGATGAGGAAACTGAAGGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2233s1c1
Sequence:CCGGGCTGCAGCAATCTGAGAAATACTCGAGTATTTCTCAGATTGCTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2530s1c1
Sequence:CCGGGCTTCAGCTCTCTGACTACAACTCGAGTTGTAGTCAGAGAGCTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-1189s1c1
Sequence:CCGGGCGGGCTATGATCTCACTCTACTCGAGTAGAGTGAGATCATAGCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2186s1c1
Sequence:CCGGGACCTCATAATCTCCTTCAATCTCGAGATTGAAGGAGATTATGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355379
PLA2G4D MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVD (cytosolic)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-412s1c1
Sequence:CCGGCGAGACCTTCAGTTTCCTCATCTCGAGATGAGGAAACTGAAGGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2233s1c1
Sequence:CCGGGCTGCAGCAATCTGAGAAATACTCGAGTATTTCTCAGATTGCTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2530s1c1
Sequence:CCGGGCTTCAGCTCTCTGACTACAACTCGAGTTGTAGTCAGAGAGCTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-1189s1c1
Sequence:CCGGGCGGGCTATGATCTCACTCTACTCGAGTAGAGTGAGATCATAGCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2186s1c1
Sequence:CCGGGACCTCATAATCTCCTTCAATCTCGAGATTGAAGGAGATTATGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355379
PLA2G4D MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVD (cytosolic)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-412s1c1
Sequence:CCGGCGAGACCTTCAGTTTCCTCATCTCGAGATGAGGAAACTGAAGGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2233s1c1
Sequence:CCGGGCTGCAGCAATCTGAGAAATACTCGAGTATTTCTCAGATTGCTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2530s1c1
Sequence:CCGGGCTTCAGCTCTCTGACTACAACTCGAGTTGTAGTCAGAGAGCTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-1189s1c1
Sequence:CCGGGCGGGCTATGATCTCACTCTACTCGAGTAGAGTGAGATCATAGCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355379.1-2186s1c1
Sequence:CCGGGACCTCATAATCTCCTTCAATCTCGAGATTGAAGGAGATTATGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178034
PLA2G4D MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IVD (cytosolic)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-1104s21c1
Sequence:CCGGTCACTCTACGGCCACCTATTGCTCGAGCAATAGGTGGCCGTAGAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178034.1-2090s1c1
Sequence:CCGGCCAAGTCTTGTACTTGTTTAACTCGAGTTAAACAAGTACAAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-145s1c1
Sequence:CCGGCCTGGTATGACCTCACCAGTTCTCGAGAACTGGTGAGGTCATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-197s1c1
Sequence:CCGGCAAGACCAGGAGCTTAGAGAACTCGAGTTCTCTAAGCTCCTGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-368s1c1
Sequence:CCGGCCAGGACTACTGTAGCCACAACTCGAGTTGTGGCTACAGTAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-551s1c1
Sequence:CCGGCTACTCCCTATCTGCGCCCTTCTCGAGAAGGGCGCAGATAGGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-858s21c1
Sequence:CCGGATGGATGTTCCTGCTCCAAATCTCGAGATTTGGAGCAGGAACATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-253s21c1
Sequence:CCGGCCGCACCTGGAATGAAGTTTACTCGAGTAAACTTCATTCCAGGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178034.3-2797s21c1
Sequence:CCGGCAGACTTTCACACCACAATTACTCGAGTAATTGTGGTGTGAAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178034.3-2823s21c1
Sequence:CCGGATGCCTGAGCAGGATAGATTTCTCGAGAAATCTATCCTGCTCAGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178034
PLA2G4D MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IVD (cytosolic)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-1104s21c1
Sequence:CCGGTCACTCTACGGCCACCTATTGCTCGAGCAATAGGTGGCCGTAGAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178034.1-2090s1c1
Sequence:CCGGCCAAGTCTTGTACTTGTTTAACTCGAGTTAAACAAGTACAAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-145s1c1
Sequence:CCGGCCTGGTATGACCTCACCAGTTCTCGAGAACTGGTGAGGTCATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-197s1c1
Sequence:CCGGCAAGACCAGGAGCTTAGAGAACTCGAGTTCTCTAAGCTCCTGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-368s1c1
Sequence:CCGGCCAGGACTACTGTAGCCACAACTCGAGTTGTGGCTACAGTAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-551s1c1
Sequence:CCGGCTACTCCCTATCTGCGCCCTTCTCGAGAAGGGCGCAGATAGGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-858s21c1
Sequence:CCGGATGGATGTTCCTGCTCCAAATCTCGAGATTTGGAGCAGGAACATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-253s21c1
Sequence:CCGGCCGCACCTGGAATGAAGTTTACTCGAGTAAACTTCATTCCAGGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178034.3-2797s21c1
Sequence:CCGGCAGACTTTCACACCACAATTACTCGAGTAATTGTGGTGTGAAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178034.3-2823s21c1
Sequence:CCGGATGCCTGAGCAGGATAGATTTCTCGAGAAATCTATCCTGCTCAGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178034
PLA2G4D MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IVD (cytosolic)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-1104s21c1
Sequence:CCGGTCACTCTACGGCCACCTATTGCTCGAGCAATAGGTGGCCGTAGAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178034.1-2090s1c1
Sequence:CCGGCCAAGTCTTGTACTTGTTTAACTCGAGTTAAACAAGTACAAGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-145s1c1
Sequence:CCGGCCTGGTATGACCTCACCAGTTCTCGAGAACTGGTGAGGTCATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-197s1c1
Sequence:CCGGCAAGACCAGGAGCTTAGAGAACTCGAGTTCTCTAAGCTCCTGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-368s1c1
Sequence:CCGGCCAGGACTACTGTAGCCACAACTCGAGTTGTGGCTACAGTAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178034.1-551s1c1
Sequence:CCGGCTACTCCCTATCTGCGCCCTTCTCGAGAAGGGCGCAGATAGGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-858s21c1
Sequence:CCGGATGGATGTTCCTGCTCCAAATCTCGAGATTTGGAGCAGGAACATCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178034.3-253s21c1
Sequence:CCGGCCGCACCTGGAATGAAGTTTACTCGAGTAAACTTCATTCCAGGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178034.3-2797s21c1
Sequence:CCGGCAGACTTTCACACCACAATTACTCGAGTAATTGTGGTGTGAAAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178034.3-2823s21c1
Sequence:CCGGATGCCTGAGCAGGATAGATTTCTCGAGAAATCTATCCTGCTCAGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)