EMAIL THIS PAGE TO A FRIEND

PLA2G7

phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)

52 Gene Product Result for
Synonyms: LDL-PLA2 LP-PLA2 PAFAD PAFAH
UniProtKB ID: Q13093, A5HTT5, Q15692, Q5VTT1, Q8IVA2
Gene ID:
Human(7941) Summary: The protein encoded by this gene is a secreted enzyme that catalyzes the degradation of platelet-activating factor to biologically inactive products. Defects in this gene are a cause of platelet-activating factor acetylhydrolase deficiency. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2009]
Mouse(27226) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Rat(301265) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Zebrafish(406470) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
domestic cat(101100812) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
dog(403848) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
chicken(395816) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
domestic guinea pig(100135600) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
naked mole-rat(101716824) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
cow(282311) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
sheep(101120960) phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1564 Human Lp-PLA2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005084 Rosetta Predictions human pricing
NM_001009353 Rosetta Predictions rat pricing
NM_013737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338931 predicted 1407
2 SASI_Hs01_00026424 predicted 1356
3 SASI_Hs01_00026425 predicted 474
4 SASI_Hs01_00026426 predicted 1122
5 SASI_Hs01_00026427 predicted 442
6 SASI_Hs01_00026429 predicted 1156
7 SASI_Hs01_00026431 predicted 456
8 SASI_Hs01_00026432 predicted 528
9 SASI_Hs01_00026433 predicted 1064
10 SASI_Hs02_00338932 predicted 360
11 SASI_Hs01_00026428 predicted 1165
12 SASI_Hs01_00026430 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038459 predicted 422
2 SASI_Rn01_00038460 predicted 682
3 SASI_Rn01_00038462 predicted 1307
4 SASI_Rn02_00199516 predicted 579
5 SASI_Rn02_00199517 predicted 1325
6 SASI_Rn01_00038463 predicted 396
7 SASI_Rn01_00038464 predicted 713
8 SASI_Rn01_00038465 predicted 323
9 SASI_Rn01_00038466 predicted 700
10 SASI_Rn01_00038467 predicted 1073
11 SASI_Rn01_00038461 predicted 429
12 SASI_Rn01_00038468 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162677 predicted 1135
2 SASI_Mm01_00162678 predicted 565
3 SASI_Mm01_00162679 predicted 706
4 SASI_Mm01_00162680 predicted 1455
5 SASI_Mm01_00162681 predicted 831
6 SASI_Mm01_00162682 predicted 1253
7 SASI_Mm01_00162684 predicted 731
8 SASI_Mm01_00162685 predicted 898
9 SASI_Mm01_00162686 predicted 863
10 SASI_Mm02_00322678 predicted 1414
11 SASI_Mm01_00162683 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005084
PLA2G7 MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-1516s21c1
Sequence:CCGGTTATTCCAGGGACCAACATTACTCGAGTAATGTTGGTCCCTGGAATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-813s21c1
Sequence:CCGGAGATCTGCATCTGCAACTTACCTCGAGGTAAGTTGCAGATGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-551s21c1
Sequence:CCGGCACCCTTTGGATCCCAAATAACTCGAGTTATTTGGGATCCAAAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-1320s1c1
Sequence:CCGGGCTCAAATTAAAGGGAGACATCTCGAGATGTCTCCCTTTAATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-684s1c1
Sequence:CCGGCAGGACACTTTATTCTGCTATCTCGAGATAGCAGAATAAAGTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-408s1c1
Sequence:CCGGCGTTGGTTGTACAGACTTAATCTCGAGATTAAGTCTGTACAACCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-1046s1c1
Sequence:CCGGCAACGGTTATTCAGACTCTTACTCGAGTAAGAGTCTGAATAACCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005084
PLA2G7 MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-1516s21c1
Sequence:CCGGTTATTCCAGGGACCAACATTACTCGAGTAATGTTGGTCCCTGGAATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-813s21c1
Sequence:CCGGAGATCTGCATCTGCAACTTACCTCGAGGTAAGTTGCAGATGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-551s21c1
Sequence:CCGGCACCCTTTGGATCCCAAATAACTCGAGTTATTTGGGATCCAAAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-1320s1c1
Sequence:CCGGGCTCAAATTAAAGGGAGACATCTCGAGATGTCTCCCTTTAATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-684s1c1
Sequence:CCGGCAGGACACTTTATTCTGCTATCTCGAGATAGCAGAATAAAGTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-408s1c1
Sequence:CCGGCGTTGGTTGTACAGACTTAATCTCGAGATTAAGTCTGTACAACCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-1046s1c1
Sequence:CCGGCAACGGTTATTCAGACTCTTACTCGAGTAAGAGTCTGAATAACCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005084
PLA2G7 MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-1516s21c1
Sequence:CCGGTTATTCCAGGGACCAACATTACTCGAGTAATGTTGGTCCCTGGAATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-813s21c1
Sequence:CCGGAGATCTGCATCTGCAACTTACCTCGAGGTAAGTTGCAGATGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005084.3-551s21c1
Sequence:CCGGCACCCTTTGGATCCCAAATAACTCGAGTTATTTGGGATCCAAAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-1320s1c1
Sequence:CCGGGCTCAAATTAAAGGGAGACATCTCGAGATGTCTCCCTTTAATTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-684s1c1
Sequence:CCGGCAGGACACTTTATTCTGCTATCTCGAGATAGCAGAATAAAGTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-408s1c1
Sequence:CCGGCGTTGGTTGTACAGACTTAATCTCGAGATTAAGTCTGTACAACCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005084.2-1046s1c1
Sequence:CCGGCAACGGTTATTCAGACTCTTACTCGAGTAAGAGTCTGAATAACCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013737
VALIDATED
PLA2G7 MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-611s21c1
Sequence:CCGGCGTTTGTACTACCCAGCTCAACTCGAGTTGAGCTGGGTAGTACAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-1019s21c1
Sequence:CCGGCGGAAAGAACAGGTTCAGCAACTCGAGTTGCTGAACCTGTTCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-1702s21c1
Sequence:CCGGGCTTGTTACACAGTTGCCTTTCTCGAGAAAGGCAACTGTGTAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-865s21c1
Sequence:CCGGCTTGGCATCTAATGGGTTTATCTCGAGATAAACCCATTAGATGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-827s21c1
Sequence:CCGGGGAGCCTTCAGGACGATTTATCTCGAGATAAATCGTCCTGAAGGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-1703s1c1
Sequence:CCGGGCTTGTTACACAGTTGCCTTTCTCGAGAAAGGCAACTGTGTAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-470s1c1
Sequence:CCGGGCCGTCAGTAATGTTTCACAACTCGAGTTGTGAAACATTACTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-866s1c1
Sequence:CCGGCTTGGCATCTAATGGGTTTATCTCGAGATAAACCCATTAGATGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-1020s1c1
Sequence:CCGGCGGAAAGAACAGGTTCAGCAACTCGAGTTGCTGAACCTGTTCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-612s1c1
Sequence:CCGGCGTTTGTACTACCCAGCTCAACTCGAGTTGAGCTGGGTAGTACAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013737
VALIDATED
PLA2G7 MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-611s21c1
Sequence:CCGGCGTTTGTACTACCCAGCTCAACTCGAGTTGAGCTGGGTAGTACAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-1019s21c1
Sequence:CCGGCGGAAAGAACAGGTTCAGCAACTCGAGTTGCTGAACCTGTTCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-1702s21c1
Sequence:CCGGGCTTGTTACACAGTTGCCTTTCTCGAGAAAGGCAACTGTGTAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-865s21c1
Sequence:CCGGCTTGGCATCTAATGGGTTTATCTCGAGATAAACCCATTAGATGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-827s21c1
Sequence:CCGGGGAGCCTTCAGGACGATTTATCTCGAGATAAATCGTCCTGAAGGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-1703s1c1
Sequence:CCGGGCTTGTTACACAGTTGCCTTTCTCGAGAAAGGCAACTGTGTAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-470s1c1
Sequence:CCGGGCCGTCAGTAATGTTTCACAACTCGAGTTGTGAAACATTACTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-866s1c1
Sequence:CCGGCTTGGCATCTAATGGGTTTATCTCGAGATAAACCCATTAGATGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-1020s1c1
Sequence:CCGGCGGAAAGAACAGGTTCAGCAACTCGAGTTGCTGAACCTGTTCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-612s1c1
Sequence:CCGGCGTTTGTACTACCCAGCTCAACTCGAGTTGAGCTGGGTAGTACAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013737
VALIDATED
PLA2G7 MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-611s21c1
Sequence:CCGGCGTTTGTACTACCCAGCTCAACTCGAGTTGAGCTGGGTAGTACAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-1019s21c1
Sequence:CCGGCGGAAAGAACAGGTTCAGCAACTCGAGTTGCTGAACCTGTTCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-1702s21c1
Sequence:CCGGGCTTGTTACACAGTTGCCTTTCTCGAGAAAGGCAACTGTGTAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-865s21c1
Sequence:CCGGCTTGGCATCTAATGGGTTTATCTCGAGATAAACCCATTAGATGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013737.5-827s21c1
Sequence:CCGGGGAGCCTTCAGGACGATTTATCTCGAGATAAATCGTCCTGAAGGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-1703s1c1
Sequence:CCGGGCTTGTTACACAGTTGCCTTTCTCGAGAAAGGCAACTGTGTAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-470s1c1
Sequence:CCGGGCCGTCAGTAATGTTTCACAACTCGAGTTGTGAAACATTACTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-866s1c1
Sequence:CCGGCTTGGCATCTAATGGGTTTATCTCGAGATAAACCCATTAGATGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-1020s1c1
Sequence:CCGGCGGAAAGAACAGGTTCAGCAACTCGAGTTGCTGAACCTGTTCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013737.2-612s1c1
Sequence:CCGGCGTTTGTACTACCCAGCTCAACTCGAGTTGAGCTGGGTAGTACAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)