EMAIL THIS PAGE TO A FRIEND

PLA2R1

phospholipase A2 receptor 1, 180kDa

100 Gene Product Result for
Synonyms: CLEC13C PLA2-R PLA2G1R PLA2IR PLA2R
Gene ID:
Human(22925) Summary: This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
Mouse(18779) phospholipase A2 receptor 1
Rat(295631) phospholipase A2 receptor 1
cow(317777) phospholipase A2 receptor 1, 180kDa
sheep(101111081) phospholipase A2 receptor 1, 180kDa
naked mole-rat(101716305) phospholipase A2 receptor 1, 180kDa
Domestic Rabbit(100009180) phospholipase A2 receptor 1, 180kDa
domestic guinea pig(100722768) phospholipase A2 receptor 1, 180kDa
chicken(404304) phospholipase A2 receptor 1, 180kDa
domestic cat(101096335) phospholipase A2 receptor 1, 180kDa
dog(488367) phospholipase A2 receptor 1, 180kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Activator

Product # Description Species Add to Cart
 
M5280 Mastoparan, Vespula lewisii ≥97% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007366 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007267 Rosetta Predictions human pricing
NM_007366 Rosetta Predictions human pricing
XM_001069062 Rosetta Predictions rat pricing
XM_215737 Rosetta Predictions rat pricing
NM_008867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305292 predicted 885
2 SASI_Hs01_00115859 predicted 799
3 SASI_Hs01_00115861 predicted 2612
4 SASI_Hs02_00305293 predicted 1357
5 SASI_Hs01_00115862 predicted 2979
6 SASI_Hs01_00115863 predicted 1559
7 SASI_Hs01_00115864 predicted 2799
8 SASI_Hs01_00115865 predicted 3003
9 SASI_Hs01_00115866 predicted 1424
10 SASI_Hs02_00305294 predicted 3552
11 SASI_Hs01_00115860 predicted 2320
12 SASI_Hs01_00115867 predicted 3410
13 SASI_Hs01_00115868 predicted 2355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343492 predicted 887
2 SASI_Hs02_00343493 predicted 802
3 SASI_Hs01_00041178 predicted 2608
4 SASI_Hs02_00343494 predicted 1352
5 SASI_Hs01_00041179 predicted 2972
6 SASI_Hs01_00041181 predicted 1558
7 SASI_Hs01_00041182 predicted 2800
8 SASI_Hs01_00041183 predicted 3000
9 SASI_Hs01_00041184 predicted 1426
10 SASI_Hs02_00343495 predicted 3551
11 SASI_Hs01_00041177 predicted 2325
12 SASI_Hs01_00041180 predicted 3001
13 SASI_Hs01_00041185 predicted 3408
14 SASI_Hs01_00041186 predicted 2362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326750 predicted 4451
2 SASI_Rn02_00326751 predicted 4524
3 SASI_Rn02_00326752 predicted 1703
4 SASI_Rn02_00326753 predicted 1311
5 SASI_Rn02_00326754 predicted 3075
6 SASI_Rn02_00326755 predicted 2656
7 SASI_Rn02_00326756 predicted 1460
8 SASI_Rn02_00326757 predicted 1221
9 SASI_Rn02_00326758 predicted 4179
10 SASI_Rn02_00326759 predicted 3847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376175 predicted 744
2 SASI_Rn02_00376176 predicted 766
3 SASI_Rn02_00376177 predicted 3748
4 SASI_Rn02_00376178 predicted 1882
5 SASI_Rn02_00376179 predicted 1702
6 SASI_Rn02_00376180 predicted 1307
7 SASI_Rn02_00376181 predicted 2649
8 SASI_Rn02_00376182 predicted 1461
9 SASI_Rn02_00376183 predicted 1219
10 SASI_Rn02_00376184 predicted 4181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061536 predicted 3179
2 SASI_Mm01_00061537 predicted 3507
3 SASI_Mm01_00061539 predicted 614
4 SASI_Mm01_00061540 predicted 3280
5 SASI_Mm01_00061541 predicted 4323
6 SASI_Mm01_00061542 predicted 4665
7 SASI_Mm02_00314840 predicted 1093
8 SASI_Mm01_00061543 predicted 1442
9 SASI_Mm01_00061544 predicted 2241
10 SASI_Mm01_00061545 predicted 1966
11 SASI_Mm01_00061538 predicted 3669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008867
VALIDATED
PLA2R1 MISSION shRNA Bacterial Glycerol Stock
phospholipase A2 receptor 1, 180kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008867.1-4949s1c1
Sequence:CCGGGCTCTCAACTAATACTTTGAACTCGAGTTCAAAGTATTAGTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-3516s1c1
Sequence:CCGGCGTGGTAATATGACTTGGTATCTCGAGATACCAAGTCATATTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-206s1c1
Sequence:CCGGCGCCCAAGATTTGACTCACATCTCGAGATGTGAGTCAAATCTTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-4206s1c1
Sequence:CCGGCCGGAAGGAATATGGCACTTTCTCGAGAAAGTGCCATATTCCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-3515s1c1
Sequence:CCGGCCGTGGTAATATGACTTGGTACTCGAGTACCAAGTCATATTACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-3786s21c1
Sequence:CCGGAGCACAGCCTGCGAGTCATTTCTCGAGAAATGACTCGCAGGCTGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-1193s21c1
Sequence:CCGGTATATGCAAACGGGATCTAAACTCGAGTTTAGATCCCGTTTGCATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-3214s21c1
Sequence:CCGGATCATGAGAAATGGGTAAATGCTCGAGCATTTACCCATTTCTCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-1451s21c1
Sequence:CCGGGATTGGTTTGAGTAGCAATAACTCGAGTTATTGCTACTCAAACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-428s21c1
Sequence:CCGGTGCTCTGGAGCAACCATTAAACTCGAGTTTAATGGTTGCTCCAGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008867
VALIDATED
PLA2R1 MISSION shRNA shRNA Plasmid DNA
phospholipase A2 receptor 1, 180kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008867.1-4949s1c1
Sequence:CCGGGCTCTCAACTAATACTTTGAACTCGAGTTCAAAGTATTAGTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-3516s1c1
Sequence:CCGGCGTGGTAATATGACTTGGTATCTCGAGATACCAAGTCATATTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-206s1c1
Sequence:CCGGCGCCCAAGATTTGACTCACATCTCGAGATGTGAGTCAAATCTTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-4206s1c1
Sequence:CCGGCCGGAAGGAATATGGCACTTTCTCGAGAAAGTGCCATATTCCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-3515s1c1
Sequence:CCGGCCGTGGTAATATGACTTGGTACTCGAGTACCAAGTCATATTACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-3786s21c1
Sequence:CCGGAGCACAGCCTGCGAGTCATTTCTCGAGAAATGACTCGCAGGCTGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-1193s21c1
Sequence:CCGGTATATGCAAACGGGATCTAAACTCGAGTTTAGATCCCGTTTGCATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-3214s21c1
Sequence:CCGGATCATGAGAAATGGGTAAATGCTCGAGCATTTACCCATTTCTCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-1451s21c1
Sequence:CCGGGATTGGTTTGAGTAGCAATAACTCGAGTTATTGCTACTCAAACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-428s21c1
Sequence:CCGGTGCTCTGGAGCAACCATTAAACTCGAGTTTAATGGTTGCTCCAGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008867
VALIDATED
PLA2R1 MISSION shRNA Lentiviral Transduction Particles
phospholipase A2 receptor 1, 180kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008867.1-4949s1c1
Sequence:CCGGGCTCTCAACTAATACTTTGAACTCGAGTTCAAAGTATTAGTTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-3516s1c1
Sequence:CCGGCGTGGTAATATGACTTGGTATCTCGAGATACCAAGTCATATTACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-206s1c1
Sequence:CCGGCGCCCAAGATTTGACTCACATCTCGAGATGTGAGTCAAATCTTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-4206s1c1
Sequence:CCGGCCGGAAGGAATATGGCACTTTCTCGAGAAAGTGCCATATTCCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008867.1-3515s1c1
Sequence:CCGGCCGTGGTAATATGACTTGGTACTCGAGTACCAAGTCATATTACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-3786s21c1
Sequence:CCGGAGCACAGCCTGCGAGTCATTTCTCGAGAAATGACTCGCAGGCTGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-1193s21c1
Sequence:CCGGTATATGCAAACGGGATCTAAACTCGAGTTTAGATCCCGTTTGCATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-3214s21c1
Sequence:CCGGATCATGAGAAATGGGTAAATGCTCGAGCATTTACCCATTTCTCATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-1451s21c1
Sequence:CCGGGATTGGTTTGAGTAGCAATAACTCGAGTTATTGCTACTCAAACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008867.1-428s21c1
Sequence:CCGGTGCTCTGGAGCAACCATTAAACTCGAGTTTAATGGTTGCTCCAGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007366
PLA2R1 MISSION shRNA Bacterial Glycerol Stock
phospholipase A2 receptor 1, 180kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-3006s1c1
Sequence:CCGGGCCTAGTATCTGTAAGCGAAACTCGAGTTTCGCTTACAGATACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-3740s1c1
Sequence:CCGGCCACAGATAATGGTCTTAATTCTCGAGAATTAAGACCATTATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-2335s1c1
Sequence:CCGGGCCCATATTGAGGAAGAGAATCTCGAGATTCTCTTCCTCAATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-830s1c1
Sequence:CCGGGCCGTTATGAAAGAGATGAAACTCGAGTTTCATCTCTTTCATAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007366.3-4695s1c1
Sequence:CCGGGAATGTGAATTGGGTCACTATCTCGAGATAGTGACCCAATTCACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-1818s21c1
Sequence:CCGGCCAAGCTTCCAGCGGTTATTACTCGAGTAATAACCGCTGGAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-1352s21c1
Sequence:CCGGGGAATCCCTACAATCGTAATTCTCGAGAATTACGATTGTAGGGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-885s21c1
Sequence:CCGGAGTAGGTTGTGATACTATTTGCTCGAGCAAATAGTATCACAACCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007366
PLA2R1 MISSION shRNA shRNA Plasmid DNA
phospholipase A2 receptor 1, 180kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-3006s1c1
Sequence:CCGGGCCTAGTATCTGTAAGCGAAACTCGAGTTTCGCTTACAGATACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-3740s1c1
Sequence:CCGGCCACAGATAATGGTCTTAATTCTCGAGAATTAAGACCATTATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-2335s1c1
Sequence:CCGGGCCCATATTGAGGAAGAGAATCTCGAGATTCTCTTCCTCAATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-830s1c1
Sequence:CCGGGCCGTTATGAAAGAGATGAAACTCGAGTTTCATCTCTTTCATAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007366.3-4695s1c1
Sequence:CCGGGAATGTGAATTGGGTCACTATCTCGAGATAGTGACCCAATTCACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-1818s21c1
Sequence:CCGGCCAAGCTTCCAGCGGTTATTACTCGAGTAATAACCGCTGGAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-1352s21c1
Sequence:CCGGGGAATCCCTACAATCGTAATTCTCGAGAATTACGATTGTAGGGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-885s21c1
Sequence:CCGGAGTAGGTTGTGATACTATTTGCTCGAGCAAATAGTATCACAACCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007366
PLA2R1 MISSION shRNA Lentiviral Transduction Particles
phospholipase A2 receptor 1, 180kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-3006s1c1
Sequence:CCGGGCCTAGTATCTGTAAGCGAAACTCGAGTTTCGCTTACAGATACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-3740s1c1
Sequence:CCGGCCACAGATAATGGTCTTAATTCTCGAGAATTAAGACCATTATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-2335s1c1
Sequence:CCGGGCCCATATTGAGGAAGAGAATCTCGAGATTCTCTTCCTCAATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007366.3-830s1c1
Sequence:CCGGGCCGTTATGAAAGAGATGAAACTCGAGTTTCATCTCTTTCATAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007366.3-4695s1c1
Sequence:CCGGGAATGTGAATTGGGTCACTATCTCGAGATAGTGACCCAATTCACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-1818s21c1
Sequence:CCGGCCAAGCTTCCAGCGGTTATTACTCGAGTAATAACCGCTGGAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-1352s21c1
Sequence:CCGGGGAATCCCTACAATCGTAATTCTCGAGAATTACGATTGTAGGGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007366.3-885s21c1
Sequence:CCGGAGTAGGTTGTGATACTATTTGCTCGAGCAAATAGTATCACAACCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)