EMAIL THIS PAGE TO A FRIEND

PLAA

phospholipase A2-activating protein

89 Gene Product Result for
Synonyms: DOA1 PLA2P PLAP
Gene ID:
Mouse(18786) phospholipase A2, activating protein
Rat(116645) phospholipase A2, activating protein
Zebrafish(324855) phospholipase A2-activating protein
chicken(427365) phospholipase A2-activating protein
dog(474733) phospholipase A2-activating protein
domestic cat(101091736) phospholipase A2-activating protein
Horse(100053453) phospholipase A2-activating protein
domestic guinea pig(100730871) phospholipase A2-activating protein
Domestic Rabbit(100349968) phospholipase A2-activating protein
naked mole-rat(101708135) phospholipase A2-activating protein
cow(506073) phospholipase A2-activating protein
sheep(101109771) phospholipase A2-activating protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031689 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031689 Rosetta Predictions human pricing
NM_004253 Rosetta Predictions human pricing
NM_053866 Rosetta Predictions rat pricing
NM_172695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197788 predicted 2067
2 SASI_Hs02_00307696 predicted 1445
3 SASI_Hs01_00197789 predicted 1372
4 SASI_Hs01_00197790 predicted 1330
5 SASI_Hs01_00197791 predicted 1344
6 SASI_Hs01_00197792 predicted 1658
7 SASI_Hs01_00197793 predicted 950
8 SASI_Hs02_00307697 predicted 579
9 SASI_Hs01_00197796 predicted 2014
10 SASI_Hs02_00307698 predicted 2205
11 SASI_Hs01_00197794 predicted 692
12 SASI_Hs01_00197795 predicted 2277
13 SASI_Hs01_00197797 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088128 predicted 1805
2 SASI_Hs02_00337194 predicted 1190
3 SASI_Hs01_00088129 predicted 1111
4 SASI_Hs01_00088130 predicted 1074
5 SASI_Hs01_00088131 predicted 1085
6 SASI_Hs01_00088132 predicted 1399
7 SASI_Hs01_00088133 predicted 701
8 SASI_Hs02_00337195 predicted 327
9 SASI_Hs01_00088136 predicted 1755
10 SASI_Hs02_00337196 predicted 1960
11 SASI_Hs01_00088134 predicted 442
12 SASI_Hs01_00088135 predicted 2029
13 SASI_Hs01_00088137 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087021 predicted 1853
2 SASI_Rn01_00087022 predicted 783
3 SASI_Rn01_00087024 predicted 2250
4 SASI_Rn01_00087025 predicted 687
5 SASI_Rn01_00087026 predicted 561
6 SASI_Rn02_00266742 predicted 286
7 SASI_Rn01_00087027 predicted 1203
8 SASI_Rn01_00087028 predicted 1399
9 SASI_Rn02_00266743 predicted 957
10 SASI_Rn02_00266744 predicted 310
11 SASI_Rn01_00087023 predicted 1210
12 SASI_Rn01_00087029 predicted 1225
13 SASI_Rn01_00087030 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162885 predicted 670
2 SASI_Mm01_00162886 predicted 425
3 SASI_Mm01_00162887 predicted 1090
4 SASI_Mm01_00162888 predicted 711
5 SASI_Mm01_00162889 predicted 2350
6 SASI_Mm01_00162890 predicted 517
7 SASI_Mm01_00162891 predicted 393
8 SASI_Mm01_00162893 predicted 1067
9 SASI_Mm01_00162894 predicted 1504
10 SASI_Mm02_00344443 predicted 1858
11 SASI_Mm01_00162892 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172695
VALIDATED
PLAA MISSION shRNA Bacterial Glycerol Stock
phospholipase A2-activating protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1751s21c1
Sequence:CCGGCCATGACTGGAGTTGATCCATCTCGAGATGGATCAACTCCAGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1863s21c1
Sequence:CCGGCCCTACACAAATATTAGGAAACTCGAGTTTCCTAATATTTGTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1477s21c1
Sequence:CCGGCCATATAATGTCAGTGACGATCTCGAGATCGTCACTGACATTATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1960s21c1
Sequence:CCGGCTGTCCCTGATTTGTAATAATCTCGAGATTATTACAAATCAGGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172695.1-2438s1c1
Sequence:CCGGGCCAAATCTTTAGGTGTTGATCTCGAGATCAACACCTAAAGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1683s1c1
Sequence:CCGGCCATGACTGGAGTTGATCCATCTCGAGATGGATCAACTCCAGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1409s1c1
Sequence:CCGGCCATATAATGTCAGTGACGATCTCGAGATCGTCACTGACATTATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1795s1c1
Sequence:CCGGCCCTACACAAATATTAGGAAACTCGAGTTTCCTAATATTTGTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172695.1-1892s1c1
Sequence:CCGGCTGTCCCTGATTTGTAATAATCTCGAGATTATTACAAATCAGGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-2506s21c1
Sequence:CCGGGCCAAATCTTTAGGTGTTGATCTCGAGATCAACACCTAAAGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172695
VALIDATED
PLAA MISSION shRNA shRNA Plasmid DNA
phospholipase A2-activating protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1751s21c1
Sequence:CCGGCCATGACTGGAGTTGATCCATCTCGAGATGGATCAACTCCAGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1863s21c1
Sequence:CCGGCCCTACACAAATATTAGGAAACTCGAGTTTCCTAATATTTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1477s21c1
Sequence:CCGGCCATATAATGTCAGTGACGATCTCGAGATCGTCACTGACATTATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1960s21c1
Sequence:CCGGCTGTCCCTGATTTGTAATAATCTCGAGATTATTACAAATCAGGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172695.1-2438s1c1
Sequence:CCGGGCCAAATCTTTAGGTGTTGATCTCGAGATCAACACCTAAAGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1683s1c1
Sequence:CCGGCCATGACTGGAGTTGATCCATCTCGAGATGGATCAACTCCAGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1409s1c1
Sequence:CCGGCCATATAATGTCAGTGACGATCTCGAGATCGTCACTGACATTATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1795s1c1
Sequence:CCGGCCCTACACAAATATTAGGAAACTCGAGTTTCCTAATATTTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172695.1-1892s1c1
Sequence:CCGGCTGTCCCTGATTTGTAATAATCTCGAGATTATTACAAATCAGGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-2506s21c1
Sequence:CCGGGCCAAATCTTTAGGTGTTGATCTCGAGATCAACACCTAAAGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172695
VALIDATED
PLAA MISSION shRNA Lentiviral Transduction Particles
phospholipase A2-activating protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1751s21c1
Sequence:CCGGCCATGACTGGAGTTGATCCATCTCGAGATGGATCAACTCCAGTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1863s21c1
Sequence:CCGGCCCTACACAAATATTAGGAAACTCGAGTTTCCTAATATTTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1477s21c1
Sequence:CCGGCCATATAATGTCAGTGACGATCTCGAGATCGTCACTGACATTATATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-1960s21c1
Sequence:CCGGCTGTCCCTGATTTGTAATAATCTCGAGATTATTACAAATCAGGGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172695.1-2438s1c1
Sequence:CCGGGCCAAATCTTTAGGTGTTGATCTCGAGATCAACACCTAAAGATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1683s1c1
Sequence:CCGGCCATGACTGGAGTTGATCCATCTCGAGATGGATCAACTCCAGTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1409s1c1
Sequence:CCGGCCATATAATGTCAGTGACGATCTCGAGATCGTCACTGACATTATATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172695.1-1795s1c1
Sequence:CCGGCCCTACACAAATATTAGGAAACTCGAGTTTCCTAATATTTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172695.1-1892s1c1
Sequence:CCGGCTGTCCCTGATTTGTAATAATCTCGAGATTATTACAAATCAGGGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172695.2-2506s21c1
Sequence:CCGGGCCAAATCTTTAGGTGTTGATCTCGAGATCAACACCTAAAGATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031689
VALIDATED
PLAA MISSION shRNA Bacterial Glycerol Stock
phospholipase A2-activating protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1746s21c1
Sequence:CCGGCCTATGTTTCTGGATCAAGTACTCGAGTACTTGATCCAGAAACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-2592s21c1
Sequence:CCGGGCCCAATGTTTGTCACTAATTCTCGAGAATTAGTGACAAACATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031689.2-3109s21c1
Sequence:CCGGCAAGGGCTGTTACTCATATAACTCGAGTTATATGAGTAACAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1655s21c1
Sequence:CCGGTGAAGGTGGACCATCATATAACTCGAGTTATATGATGGTCCACCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1087s21c1
Sequence:CCGGGCGAGTGTCTTGAAGTATATTCTCGAGAATATACTTCAAGACACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031689
VALIDATED
PLAA MISSION shRNA shRNA Plasmid DNA
phospholipase A2-activating protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1746s21c1
Sequence:CCGGCCTATGTTTCTGGATCAAGTACTCGAGTACTTGATCCAGAAACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-2592s21c1
Sequence:CCGGGCCCAATGTTTGTCACTAATTCTCGAGAATTAGTGACAAACATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031689.2-3109s21c1
Sequence:CCGGCAAGGGCTGTTACTCATATAACTCGAGTTATATGAGTAACAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1655s21c1
Sequence:CCGGTGAAGGTGGACCATCATATAACTCGAGTTATATGATGGTCCACCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1087s21c1
Sequence:CCGGGCGAGTGTCTTGAAGTATATTCTCGAGAATATACTTCAAGACACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031689
VALIDATED
PLAA MISSION shRNA Lentiviral Transduction Particles
phospholipase A2-activating protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1746s21c1
Sequence:CCGGCCTATGTTTCTGGATCAAGTACTCGAGTACTTGATCCAGAAACATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-2592s21c1
Sequence:CCGGGCCCAATGTTTGTCACTAATTCTCGAGAATTAGTGACAAACATTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031689.2-3109s21c1
Sequence:CCGGCAAGGGCTGTTACTCATATAACTCGAGTTATATGAGTAACAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1655s21c1
Sequence:CCGGTGAAGGTGGACCATCATATAACTCGAGTTATATGATGGTCCACCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001031689.2-1087s21c1
Sequence:CCGGGCGAGTGTCTTGAAGTATATTCTCGAGAATATACTTCAAGACACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004253
VALIDATED
PLAA MISSION shRNA Bacterial Glycerol Stock
phospholipase A2-activating protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-1178s1c1
Sequence:CCGGCCTATGTTTCTGGATCAAGTACTCGAGTACTTGATCCAGAAACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-519s1c1
Sequence:CCGGGCGAGTGTCTTGAAGTATATTCTCGAGAATATACTTCAAGACACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-1911s1c1
Sequence:CCGGCCCATGCAATAGAACTGAAATCTCGAGATTTCAGTTCTATTGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-2024s1c1
Sequence:CCGGGCCCAATGTTTGTCACTAATTCTCGAGAATTAGTGACAAACATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-117s1c1
Sequence:CCGGCCGGTGGAAATGACCACAATACTCGAGTATTGTGGTCATTTCCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004253
VALIDATED
PLAA MISSION shRNA shRNA Plasmid DNA
phospholipase A2-activating protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-1178s1c1
Sequence:CCGGCCTATGTTTCTGGATCAAGTACTCGAGTACTTGATCCAGAAACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-519s1c1
Sequence:CCGGGCGAGTGTCTTGAAGTATATTCTCGAGAATATACTTCAAGACACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-1911s1c1
Sequence:CCGGCCCATGCAATAGAACTGAAATCTCGAGATTTCAGTTCTATTGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-2024s1c1
Sequence:CCGGGCCCAATGTTTGTCACTAATTCTCGAGAATTAGTGACAAACATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-117s1c1
Sequence:CCGGCCGGTGGAAATGACCACAATACTCGAGTATTGTGGTCATTTCCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004253
VALIDATED
PLAA MISSION shRNA Lentiviral Transduction Particles
phospholipase A2-activating protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-1178s1c1
Sequence:CCGGCCTATGTTTCTGGATCAAGTACTCGAGTACTTGATCCAGAAACATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-519s1c1
Sequence:CCGGGCGAGTGTCTTGAAGTATATTCTCGAGAATATACTTCAAGACACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-1911s1c1
Sequence:CCGGCCCATGCAATAGAACTGAAATCTCGAGATTTCAGTTCTATTGCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-2024s1c1
Sequence:CCGGGCCCAATGTTTGTCACTAATTCTCGAGAATTAGTGACAAACATTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004253.2-117s1c1
Sequence:CCGGCCGGTGGAAATGACCACAATACTCGAGTATTGTGGTCATTTCCACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)