EMAIL THIS PAGE TO A FRIEND

PLAC1

placenta-specific 1

79 Gene Product Result for
Synonyms: CT92
UniProtKB ID: Q9HBJ0
Gene ID:
Mouse(56096) placental specific protein 1
Rat(317316) placenta-specific 1
cow(767997) placenta-specific 1
sheep(101108458) placenta-specific 1
naked mole-rat(101706083) placenta-specific 1
domestic guinea pig(100727631) placenta-specific 1
Horse(100056361) placenta-specific 1
dog(100683010) placenta-specific 1
domestic cat(101088065) placenta-specific 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021796 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021796 Rosetta Predictions human pricing
NM_001024894 Rosetta Predictions rat pricing
NM_019538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223703 predicted 722
2 SASI_Hs01_00223704 predicted 334
3 SASI_Hs01_00223705 predicted 895
4 SASI_Hs01_00223706 predicted 713
5 SASI_Hs01_00223708 predicted 542
6 SASI_Hs01_00223709 predicted 502
7 SASI_Hs01_00223710 predicted 878
8 SASI_Hs01_00223711 predicted 361
9 SASI_Hs01_00223712 predicted 736
10 SASI_Hs02_00355098 predicted 363
11 SASI_Hs01_00223707 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202791 predicted 425
2 SASI_Rn01_00051124 predicted 768
3 SASI_Rn01_00051125 predicted 437
4 SASI_Rn02_00202792 predicted 836
5 SASI_Rn01_00051127 predicted 784
6 SASI_Rn01_00051128 predicted 406
7 SASI_Rn01_00051129 predicted 299
8 SASI_Rn01_00051130 predicted 542
9 SASI_Rn01_00051131 predicted 460
10 SASI_Rn01_00051132 predicted 497
11 SASI_Rn01_00051126 predicted 794
12 SASI_Rn01_00051133 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134410 predicted 435
2 SASI_Mm01_00134411 predicted 421
3 SASI_Mm01_00134413 predicted 315
4 SASI_Mm01_00134414 predicted 428
5 SASI_Mm01_00134415 predicted 467
6 SASI_Mm01_00134416 predicted 727
7 SASI_Mm01_00134417 predicted 504
8 SASI_Mm01_00134418 predicted 442
9 SASI_Mm01_00134419 predicted 514
10 SASI_Mm02_00324571 predicted 451
11 SASI_Mm01_00134412 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021796
VALIDATED
PLAC1 MISSION shRNA Bacterial Glycerol Stock
placenta-specific 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-861s1c1
Sequence:CCGGGCCATCTCACTTTCTTGATATCTCGAGATATCAAGAAAGTGAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-889s1c1
Sequence:CCGGGATTGGTCTCTTCACACAGATCTCGAGATCTGTGTGAAGAGACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-420s1c1
Sequence:CCGGGCTAAACAACGATGTGTGTGTCTCGAGACACACACATCGTTGTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021796.1-714s1c1
Sequence:CCGGGAAGGATGAGAAATGCTACGACTCGAGTCGTAGCATTTCTCATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021796.1-505s1c1
Sequence:CCGGCAGTTCACCTACCGTGTTACTCTCGAGAGTAACACGGTAGGTGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-543s1c1
Sequence:CCGGCAAAGCTGTCTCTCAGGACATCTCGAGATGTCCTGAGAGACAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-795s1c1
Sequence:CCGGCAGTGAAGAAGAGCATACCCACTCGAGTGGGTATGCTCTTCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-348s1c1
Sequence:CCGGCGGTTCAGGACAAAGTCCAATCTCGAGATTGGACTTTGTCCTGAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-784s1c1
Sequence:CCGGCCTTGTGTCTTCAGTGAAGAACTCGAGTTCTTCACTGAAGACACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-552s1c1
Sequence:CCGGCTCTCAGGACATGGTTATCTACTCGAGTAGATAACCATGTCCTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-779s21c1
Sequence:CCGGCCTTGTGTCTTCAGTGAAGAACTCGAGTTCTTCACTGAAGACACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-856s21c1
Sequence:CCGGGCCATCTCACTTTCTTGATATCTCGAGATATCAAGAAAGTGAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-343s21c1
Sequence:CCGGCGGTTCAGGACAAAGTCCAATCTCGAGATTGGACTTTGTCCTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-884s21c1
Sequence:CCGGGATTGGTCTCTTCACACAGATCTCGAGATCTGTGTGAAGAGACCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021796
VALIDATED
PLAC1 MISSION shRNA shRNA Plasmid DNA
placenta-specific 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-861s1c1
Sequence:CCGGGCCATCTCACTTTCTTGATATCTCGAGATATCAAGAAAGTGAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-889s1c1
Sequence:CCGGGATTGGTCTCTTCACACAGATCTCGAGATCTGTGTGAAGAGACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-420s1c1
Sequence:CCGGGCTAAACAACGATGTGTGTGTCTCGAGACACACACATCGTTGTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021796.1-714s1c1
Sequence:CCGGGAAGGATGAGAAATGCTACGACTCGAGTCGTAGCATTTCTCATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021796.1-505s1c1
Sequence:CCGGCAGTTCACCTACCGTGTTACTCTCGAGAGTAACACGGTAGGTGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-543s1c1
Sequence:CCGGCAAAGCTGTCTCTCAGGACATCTCGAGATGTCCTGAGAGACAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-795s1c1
Sequence:CCGGCAGTGAAGAAGAGCATACCCACTCGAGTGGGTATGCTCTTCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-348s1c1
Sequence:CCGGCGGTTCAGGACAAAGTCCAATCTCGAGATTGGACTTTGTCCTGAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-784s1c1
Sequence:CCGGCCTTGTGTCTTCAGTGAAGAACTCGAGTTCTTCACTGAAGACACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-552s1c1
Sequence:CCGGCTCTCAGGACATGGTTATCTACTCGAGTAGATAACCATGTCCTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-779s21c1
Sequence:CCGGCCTTGTGTCTTCAGTGAAGAACTCGAGTTCTTCACTGAAGACACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-856s21c1
Sequence:CCGGGCCATCTCACTTTCTTGATATCTCGAGATATCAAGAAAGTGAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-343s21c1
Sequence:CCGGCGGTTCAGGACAAAGTCCAATCTCGAGATTGGACTTTGTCCTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-884s21c1
Sequence:CCGGGATTGGTCTCTTCACACAGATCTCGAGATCTGTGTGAAGAGACCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021796
VALIDATED
PLAC1 MISSION shRNA Lentiviral Transduction Particles
placenta-specific 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-861s1c1
Sequence:CCGGGCCATCTCACTTTCTTGATATCTCGAGATATCAAGAAAGTGAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-889s1c1
Sequence:CCGGGATTGGTCTCTTCACACAGATCTCGAGATCTGTGTGAAGAGACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-420s1c1
Sequence:CCGGGCTAAACAACGATGTGTGTGTCTCGAGACACACACATCGTTGTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021796.1-714s1c1
Sequence:CCGGGAAGGATGAGAAATGCTACGACTCGAGTCGTAGCATTTCTCATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021796.1-505s1c1
Sequence:CCGGCAGTTCACCTACCGTGTTACTCTCGAGAGTAACACGGTAGGTGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021796.1-543s1c1
Sequence:CCGGCAAAGCTGTCTCTCAGGACATCTCGAGATGTCCTGAGAGACAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-795s1c1
Sequence:CCGGCAGTGAAGAAGAGCATACCCACTCGAGTGGGTATGCTCTTCTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-348s1c1
Sequence:CCGGCGGTTCAGGACAAAGTCCAATCTCGAGATTGGACTTTGTCCTGAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-784s1c1
Sequence:CCGGCCTTGTGTCTTCAGTGAAGAACTCGAGTTCTTCACTGAAGACACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021796.1-552s1c1
Sequence:CCGGCTCTCAGGACATGGTTATCTACTCGAGTAGATAACCATGTCCTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-779s21c1
Sequence:CCGGCCTTGTGTCTTCAGTGAAGAACTCGAGTTCTTCACTGAAGACACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-856s21c1
Sequence:CCGGGCCATCTCACTTTCTTGATATCTCGAGATATCAAGAAAGTGAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-343s21c1
Sequence:CCGGCGGTTCAGGACAAAGTCCAATCTCGAGATTGGACTTTGTCCTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021796.3-884s21c1
Sequence:CCGGGATTGGTCTCTTCACACAGATCTCGAGATCTGTGTGAAGAGACCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019538
PLAC1 MISSION shRNA Bacterial Glycerol Stock
placenta-specific 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019538.3-731s1c1
Sequence:CCGGCCACCTTATGTCTACAATCAACTCGAGTTGATTGTAGACATAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019538.3-657s1c1
Sequence:CCGGCGACTCCGAAGAATGATACTTCTCGAGAAGTATCATTCTTCGGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-546s21c1
Sequence:CCGGCAAGGGCTCATCAACGAAATACTCGAGTATTTCGTTGATGAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-521s21c1
Sequence:CCGGATAGCTCTGAGATTCACTATGCTCGAGCATAGTGAATCTCAGAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019538.4-805s21c1
Sequence:CCGGTAGTCATCTGACTGTGCAAATCTCGAGATTTGCACAGTCAGATGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-321s21c1
Sequence:CCGGTGTGCTGTGCTCGACAGATTGCTCGAGCAATCTGTCGAGCACAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-440s21c1
Sequence:CCGGACCCACATTTCTACCAGTTTCCTCGAGGAAACTGGTAGAAATGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019538
PLAC1 MISSION shRNA shRNA Plasmid DNA
placenta-specific 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019538.3-731s1c1
Sequence:CCGGCCACCTTATGTCTACAATCAACTCGAGTTGATTGTAGACATAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019538.3-657s1c1
Sequence:CCGGCGACTCCGAAGAATGATACTTCTCGAGAAGTATCATTCTTCGGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-546s21c1
Sequence:CCGGCAAGGGCTCATCAACGAAATACTCGAGTATTTCGTTGATGAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-521s21c1
Sequence:CCGGATAGCTCTGAGATTCACTATGCTCGAGCATAGTGAATCTCAGAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019538.4-805s21c1
Sequence:CCGGTAGTCATCTGACTGTGCAAATCTCGAGATTTGCACAGTCAGATGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-321s21c1
Sequence:CCGGTGTGCTGTGCTCGACAGATTGCTCGAGCAATCTGTCGAGCACAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-440s21c1
Sequence:CCGGACCCACATTTCTACCAGTTTCCTCGAGGAAACTGGTAGAAATGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019538
PLAC1 MISSION shRNA Lentiviral Transduction Particles
placenta-specific 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019538.3-731s1c1
Sequence:CCGGCCACCTTATGTCTACAATCAACTCGAGTTGATTGTAGACATAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019538.3-657s1c1
Sequence:CCGGCGACTCCGAAGAATGATACTTCTCGAGAAGTATCATTCTTCGGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-546s21c1
Sequence:CCGGCAAGGGCTCATCAACGAAATACTCGAGTATTTCGTTGATGAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-521s21c1
Sequence:CCGGATAGCTCTGAGATTCACTATGCTCGAGCATAGTGAATCTCAGAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019538.4-805s21c1
Sequence:CCGGTAGTCATCTGACTGTGCAAATCTCGAGATTTGCACAGTCAGATGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-321s21c1
Sequence:CCGGTGTGCTGTGCTCGACAGATTGCTCGAGCAATCTGTCGAGCACAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019538.4-440s21c1
Sequence:CCGGACCCACATTTCTACCAGTTTCCTCGAGGAAACTGGTAGAAATGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)