EMAIL THIS PAGE TO A FRIEND

PLAC8L1

PLAC8-like 1

71 Gene Product Result for
UniProtKB ID: A1L4L8
Gene ID:
Mouse(69401) PLAC8-like 1
Rat(364853) PLAC8-like 1
Zebrafish(797097) PLAC8-like 1
dog(100686169) PLAC8-like 1
Horse(100071986) PLAC8-like 1
cow(618331) PLAC8-like 1
sheep(101111880) PLAC8-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA074266 Anti-PLAC8L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121941 MISSION® esiRNA esiRNA human PLAC8L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029869 Rosetta Predictions human pricing
XR_005967 Rosetta Predictions rat pricing
XR_008478 Rosetta Predictions rat pricing
XM_484719 Rosetta Predictions mouse pricing
XM_910139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131889 predicted 491
2 SASI_Hs01_00131890 predicted 317
3 SASI_Hs01_00131891 predicted 304
4 SASI_Hs01_00131892 predicted 307
5 SASI_Hs01_00131894 predicted 248
6 SASI_Hs01_00131896 predicted 306
7 SASI_Hs01_00131897 predicted 246
8 SASI_Hs02_00307544 predicted 387
9 SASI_Hs02_00307545 predicted 386
10 SASI_Hs02_00307546 predicted 376
11 SASI_Hs01_00131893 predicted 299
12 SASI_Hs01_00131895 predicted 297
13 SASI_Hs01_00131898 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159764 predicted 516
2 SASI_Rn01_00159765 predicted 345
3 SASI_Rn01_00159767 predicted 274
4 SASI_Rn01_00159768 predicted 534
5 SASI_Rn01_00159769 predicted 301
6 SASI_Rn01_00159770 predicted 652
7 SASI_Rn01_00159771 predicted 281
8 SASI_Rn01_00159772 predicted 407
9 SASI_Rn01_00159773 predicted 522
10 SASI_Rn02_00410683 predicted 237
11 SASI_Rn01_00159766 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183928 predicted 514
2 SASI_Rn01_00183929 predicted 342
3 SASI_Rn01_00183931 predicted 273
4 SASI_Rn01_00183932 predicted 526
5 SASI_Rn01_00183933 predicted 294
6 SASI_Rn01_00183934 predicted 646
7 SASI_Rn01_00183935 predicted 289
8 SASI_Rn01_00183936 predicted 409
9 SASI_Rn01_00183937 predicted 527
10 SASI_Rn02_00417133 predicted 235
11 SASI_Rn01_00183930 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282273 predicted 346
2 SASI_Mm01_00282274 predicted 401
3 SASI_Mm02_00426525 predicted 332
4 SASI_Mm01_00282275 predicted 375
5 SASI_Mm01_00282276 predicted 400
6 SASI_Mm01_00282280 predicted 400
7 SASI_Mm01_00282281 predicted 365
8 SASI_Mm01_00282282 predicted 346
9 SASI_Mm02_00426526 predicted 387
10 SASI_Mm02_00426527 predicted 233
11 SASI_Mm01_00282277 predicted 385
12 SASI_Mm01_00282278 predicted 386
13 SASI_Mm01_00282279 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435369 predicted 351
2 SASI_Mm02_00435370 predicted 399
3 SASI_Mm02_00435371 predicted 370
4 SASI_Mm02_00435372 predicted 401
5 SASI_Mm02_00435373 predicted 378
6 SASI_Mm02_00435374 predicted 377
7 SASI_Mm02_00435375 predicted 419
8 SASI_Mm02_00435376 predicted 400
9 SASI_Mm02_00435377 predicted 364
10 SASI_Mm02_00435378 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029869
PLAC8L1 MISSION shRNA Bacterial Glycerol Stock
PLAC8-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-246s1c1
Sequence:CCGGCAGGACGACAATCACAGCAATCTCGAGATTGCTGTGATTGTCGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-311s1c1
Sequence:CCGGGCAGAGATAGGAGAATTTGTTCTCGAGAACAAATTCTCCTATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-549s1c1
Sequence:CCGGGACCTCCCAAGTCTATGAAATCTCGAGATTTCATAGACTTGGGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-365s21c1
Sequence:CCGGGTGACATCGCCAGGCATTATGCTCGAGCATAATGCCTGGCGATGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-556s1c1
Sequence:CCGGCAAGTCTATGAAATCTGTGCACTCGAGTGCACAGATTTCATAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-126s1c1
Sequence:CCGGCAACATATACTCACCTCTGTTCTCGAGAACAGAGGTGAGTATATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-585s21c1
Sequence:CCGGGACTAAGGACACCCTGGTTTGCTCGAGCAAACCAGGGTGTCCTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-407s21c1
Sequence:CCCGTGTTACCTGGGTCCACCTTTGCTCGAGCAAAGGTGGACCCAGGTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029869
PLAC8L1 MISSION shRNA shRNA Plasmid DNA
PLAC8-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-246s1c1
Sequence:CCGGCAGGACGACAATCACAGCAATCTCGAGATTGCTGTGATTGTCGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-311s1c1
Sequence:CCGGGCAGAGATAGGAGAATTTGTTCTCGAGAACAAATTCTCCTATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-549s1c1
Sequence:CCGGGACCTCCCAAGTCTATGAAATCTCGAGATTTCATAGACTTGGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-365s21c1
Sequence:CCGGGTGACATCGCCAGGCATTATGCTCGAGCATAATGCCTGGCGATGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-556s1c1
Sequence:CCGGCAAGTCTATGAAATCTGTGCACTCGAGTGCACAGATTTCATAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-126s1c1
Sequence:CCGGCAACATATACTCACCTCTGTTCTCGAGAACAGAGGTGAGTATATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-585s21c1
Sequence:CCGGGACTAAGGACACCCTGGTTTGCTCGAGCAAACCAGGGTGTCCTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-407s21c1
Sequence:CCCGTGTTACCTGGGTCCACCTTTGCTCGAGCAAAGGTGGACCCAGGTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029869
PLAC8L1 MISSION shRNA Lentiviral Transduction Particles
PLAC8-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-246s1c1
Sequence:CCGGCAGGACGACAATCACAGCAATCTCGAGATTGCTGTGATTGTCGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-311s1c1
Sequence:CCGGGCAGAGATAGGAGAATTTGTTCTCGAGAACAAATTCTCCTATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-549s1c1
Sequence:CCGGGACCTCCCAAGTCTATGAAATCTCGAGATTTCATAGACTTGGGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-365s21c1
Sequence:CCGGGTGACATCGCCAGGCATTATGCTCGAGCATAATGCCTGGCGATGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-556s1c1
Sequence:CCGGCAAGTCTATGAAATCTGTGCACTCGAGTGCACAGATTTCATAGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029869.1-126s1c1
Sequence:CCGGCAACATATACTCACCTCTGTTCTCGAGAACAGAGGTGAGTATATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-585s21c1
Sequence:CCGGGACTAAGGACACCCTGGTTTGCTCGAGCAAACCAGGGTGTCCTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029869.1-407s21c1
Sequence:CCCGTGTTACCTGGGTCCACCTTTGCTCGAGCAAAGGTGGACCCAGGTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027072
PLAC8L1 MISSION shRNA Bacterial Glycerol Stock
PLAC8-like 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000347406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-451s21c1
Sequence:CCGGTGGCACCAGAGAAAGACATAGCTCGAGCTATGTCTTTCTCTGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-170s21c1
Sequence:CCGGCCCTCTGAAGATGAGCATTTACTCGAGTAAATGCTCATCTTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-377s21c1
Sequence:CCGGTGTGACATTGCCAGGCATTACCTCGAGGTAATGCCTGGCAATGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027072
PLAC8L1 MISSION shRNA shRNA Plasmid DNA
PLAC8-like 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000347406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-451s21c1
Sequence:CCGGTGGCACCAGAGAAAGACATAGCTCGAGCTATGTCTTTCTCTGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-170s21c1
Sequence:CCGGCCCTCTGAAGATGAGCATTTACTCGAGTAAATGCTCATCTTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-377s21c1
Sequence:CCGGTGTGACATTGCCAGGCATTACCTCGAGGTAATGCCTGGCAATGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027072
PLAC8L1 MISSION shRNA Lentiviral Transduction Particles
PLAC8-like 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000347406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-451s21c1
Sequence:CCGGTGGCACCAGAGAAAGACATAGCTCGAGCTATGTCTTTCTCTGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-170s21c1
Sequence:CCGGCCCTCTGAAGATGAGCATTTACTCGAGTAAATGCTCATCTTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027072.1-377s21c1
Sequence:CCGGTGTGACATTGCCAGGCATTACCTCGAGGTAATGCCTGGCAATGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)