EMAIL THIS PAGE TO A FRIEND

PLAG1

pleiomorphic adenoma gene 1

329 Gene Product Result for
Synonyms: PSA SGPA ZNF912
UniProtKB ID: Q6DJT9, B4DLC2, Q59GH8, Q9Y4L2
Gene ID:
Human(5324) Summary: Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56711) pleiomorphic adenoma gene 1
Rat(297804) pleiomorphic adenoma gene 1
cow(539210) pleiomorphic adenoma gene 1
sheep(101115630) pleiomorphic adenoma gene 1
domestic guinea pig(100735264) pleiomorphic adenoma gene 1
naked mole-rat(101726274) pleiomorphic adenoma gene 1
Domestic Rabbit(100341766) pleiomorphic adenoma gene 1
Zebrafish(561450) pleiomorphic adenoma gene 1
Horse(100053040) pleiomorphic adenoma gene 1
domestic cat(101097299) pleiomorphic adenoma gene 1
dog(486960) pleiomorphic adenoma gene 1
chicken(429484) pleiomorphic adenoma gene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114634 Rosetta Predictions human pricing
NM_001114635 Rosetta Predictions human pricing
NM_002655 Rosetta Predictions human pricing
NM_001008316 Rosetta Predictions rat pricing
NM_019969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326724 predicted 1198
2 SASI_Hs02_00326725 predicted 1729
3 SASI_Hs02_00326726 predicted 1023
4 SASI_Hs02_00326727 predicted 1564
5 SASI_Hs02_00326728 predicted 1346
6 SASI_Hs02_00326729 predicted 1306
7 SASI_Hs02_00326730 predicted 1154
8 SASI_Hs02_00326731 predicted 1865
9 SASI_Hs02_00326732 predicted 1466
10 SASI_Hs02_00326733 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326734 predicted 837
2 SASI_Hs02_00326735 predicted 1367
3 SASI_Hs02_00326736 predicted 664
4 SASI_Hs02_00326737 predicted 1197
5 SASI_Hs02_00326738 predicted 983
6 SASI_Hs02_00326739 predicted 941
7 SASI_Hs02_00326740 predicted 796
8 SASI_Hs02_00326741 predicted 1510
9 SASI_Hs02_00326742 predicted 1104
10 SASI_Hs02_00326743 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155522 predicted 1304
2 SASI_Hs02_00334201 predicted 1829
3 SASI_Hs01_00155524 predicted 1127
4 SASI_Hs02_00334202 predicted 1665
5 SASI_Hs02_00334203 predicted 1445
6 SASI_Hs01_00155525 predicted 1408
7 SASI_Hs02_00334204 predicted 1265
8 SASI_Hs01_00155528 predicted 1974
9 SASI_Hs02_00334205 predicted 1566
10 SASI_Hs02_00334206 predicted 1510
11 SASI_Hs01_00155519 predicted 873
12 SASI_Hs01_00155520 predicted 1555
13 SASI_Hs01_00155521 predicted 859
14 SASI_Hs01_00155523 predicted 910
15 SASI_Hs01_00155526 predicted 812
16 SASI_Hs01_00155527 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072986 predicted 1448
2 SASI_Rn01_00072987 predicted 1140
3 SASI_Rn01_00072988 predicted 1281
4 SASI_Rn02_00199052 predicted 1577
5 SASI_Rn01_00072990 predicted 1618
6 SASI_Rn01_00072992 predicted 1067
7 SASI_Rn01_00072993 predicted 1147
8 SASI_Rn01_00072994 predicted 1506
9 SASI_Rn01_00072995 predicted 1246
10 SASI_Rn02_00199053 predicted 1239
11 SASI_Rn01_00072989 predicted 1411
12 SASI_Rn01_00072991 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325271 predicted 1983
2 SASI_Mm01_00179035 predicted 1345
3 SASI_Mm01_00179036 predicted 1830
4 SASI_Mm01_00179037 predicted 1204
5 SASI_Mm01_00179038 predicted 1383
6 SASI_Mm01_00179040 predicted 1270
7 SASI_Mm01_00179041 predicted 895
8 SASI_Mm01_00179042 predicted 1438
9 SASI_Mm01_00179043 predicted 1433
10 SASI_Mm01_00179044 predicted 1491
11 SASI_Mm01_00179039 predicted 1826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002655
VALIDATED
PLAG1 MISSION shRNA Bacterial Glycerol Stock
pleiomorphic adenoma gene 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-846s21c1
Sequence:CCGGCCCTAACAAAGAGACGTTTAACTCGAGTTAAACGTCTCTTTGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-4810s21c1
Sequence:CCGGATGAGGCAGACTCGCTTATTTCTCGAGAAATAAGCGAGTCTGCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-1269s21c1
Sequence:GTACCGGCAATGTGTCTGTGCCTATAAACTCGAGTTTATAGGCACAGACACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002655.2-891s21c1
Sequence:GTACCGGCAATACCAAGCTTGGATTTAACTCGAGTTAAATCCAAGCTTGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-1176s21c1
Sequence:CCGGGGATCACCTGACTCGACATATCTCGAGATATGTCGAGTCAGGTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002655.1-1392s1c1
Sequence:CCGGCCACCAAATGATCACAACTTTCTCGAGAAAGTTGTGATCATTTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002655.1-7161s1c1
Sequence:CCGGGCAGACTATTTATTGTCCATACTCGAGTATGGACAATAAATAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002655.1-1928s1c1
Sequence:CCGGCCAGCAGTTTAAGCACAAGTACTCGAGTACTTGTGCTTAAACTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002655.1-1467s1c1
Sequence:CCGGCCTTTCTTTCAAATATCCGTTCTCGAGAACGGATATTTGAAAGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002655.1-822s1c1
Sequence:CCGGCGACCCTAACAAAGAGACGTTCTCGAGAACGTCTCTTTGTTAGGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002655
VALIDATED
PLAG1 MISSION shRNA shRNA Plasmid DNA
pleiomorphic adenoma gene 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-846s21c1
Sequence:CCGGCCCTAACAAAGAGACGTTTAACTCGAGTTAAACGTCTCTTTGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-4810s21c1
Sequence:CCGGATGAGGCAGACTCGCTTATTTCTCGAGAAATAAGCGAGTCTGCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-1269s21c1
Sequence:GTACCGGCAATGTGTCTGTGCCTATAAACTCGAGTTTATAGGCACAGACACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002655.2-891s21c1
Sequence:GTACCGGCAATACCAAGCTTGGATTTAACTCGAGTTAAATCCAAGCTTGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-1176s21c1
Sequence:CCGGGGATCACCTGACTCGACATATCTCGAGATATGTCGAGTCAGGTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002655.1-1392s1c1
Sequence:CCGGCCACCAAATGATCACAACTTTCTCGAGAAAGTTGTGATCATTTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002655.1-7161s1c1
Sequence:CCGGGCAGACTATTTATTGTCCATACTCGAGTATGGACAATAAATAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002655.1-1928s1c1
Sequence:CCGGCCAGCAGTTTAAGCACAAGTACTCGAGTACTTGTGCTTAAACTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002655.1-1467s1c1
Sequence:CCGGCCTTTCTTTCAAATATCCGTTCTCGAGAACGGATATTTGAAAGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002655.1-822s1c1
Sequence:CCGGCGACCCTAACAAAGAGACGTTCTCGAGAACGTCTCTTTGTTAGGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002655
VALIDATED
PLAG1 MISSION shRNA Lentiviral Transduction Particles
pleiomorphic adenoma gene 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-846s21c1
Sequence:CCGGCCCTAACAAAGAGACGTTTAACTCGAGTTAAACGTCTCTTTGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-4810s21c1
Sequence:CCGGATGAGGCAGACTCGCTTATTTCTCGAGAAATAAGCGAGTCTGCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-1269s21c1
Sequence:GTACCGGCAATGTGTCTGTGCCTATAAACTCGAGTTTATAGGCACAGACACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002655.2-891s21c1
Sequence:GTACCGGCAATACCAAGCTTGGATTTAACTCGAGTTAAATCCAAGCTTGGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002655.2-1176s21c1
Sequence:CCGGGGATCACCTGACTCGACATATCTCGAGATATGTCGAGTCAGGTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002655.1-1392s1c1
Sequence:CCGGCCACCAAATGATCACAACTTTCTCGAGAAAGTTGTGATCATTTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002655.1-7161s1c1
Sequence:CCGGGCAGACTATTTATTGTCCATACTCGAGTATGGACAATAAATAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002655.1-1928s1c1
Sequence:CCGGCCAGCAGTTTAAGCACAAGTACTCGAGTACTTGTGCTTAAACTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002655.1-1467s1c1
Sequence:CCGGCCTTTCTTTCAAATATCCGTTCTCGAGAACGGATATTTGAAAGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002655.1-822s1c1
Sequence:CCGGCGACCCTAACAAAGAGACGTTCTCGAGAACGTCTCTTTGTTAGGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019969
PLAG1 MISSION shRNA Bacterial Glycerol Stock
pleiomorphic adenoma gene 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019969.2-2332s1c1
Sequence:CCGGGCGCCATTATTATCACTAAATCTCGAGATTTAGTGATAATAATGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-794s1c1
Sequence:CCGGGCCTTTGTTTCTAAGTACAAACTCGAGTTTGTACTTAGAAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1532s1c1
Sequence:CCGGCCCATAGATATGGATGCTGTTCTCGAGAACAGCATCCATATCTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1234s1c1
Sequence:CCGGCGCACAGAGATTTGGACGAAACTCGAGTTTCGTCCAAATCTCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1036s1c1
Sequence:CCGGCAAGGTGTGTTTGCAGAATTTCTCGAGAAATTCTGCAAACACACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019969
PLAG1 MISSION shRNA shRNA Plasmid DNA
pleiomorphic adenoma gene 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019969.2-2332s1c1
Sequence:CCGGGCGCCATTATTATCACTAAATCTCGAGATTTAGTGATAATAATGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-794s1c1
Sequence:CCGGGCCTTTGTTTCTAAGTACAAACTCGAGTTTGTACTTAGAAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1532s1c1
Sequence:CCGGCCCATAGATATGGATGCTGTTCTCGAGAACAGCATCCATATCTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1234s1c1
Sequence:CCGGCGCACAGAGATTTGGACGAAACTCGAGTTTCGTCCAAATCTCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1036s1c1
Sequence:CCGGCAAGGTGTGTTTGCAGAATTTCTCGAGAAATTCTGCAAACACACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019969
PLAG1 MISSION shRNA Lentiviral Transduction Particles
pleiomorphic adenoma gene 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019969.2-2332s1c1
Sequence:CCGGGCGCCATTATTATCACTAAATCTCGAGATTTAGTGATAATAATGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-794s1c1
Sequence:CCGGGCCTTTGTTTCTAAGTACAAACTCGAGTTTGTACTTAGAAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1532s1c1
Sequence:CCGGCCCATAGATATGGATGCTGTTCTCGAGAACAGCATCCATATCTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1234s1c1
Sequence:CCGGCGCACAGAGATTTGGACGAAACTCGAGTTTCGTCCAAATCTCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019969.2-1036s1c1
Sequence:CCGGCAAGGTGTGTTTGCAGAATTTCTCGAGAAATTCTGCAAACACACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)