EMAIL THIS PAGE TO A FRIEND

PLAGL1

pleiomorphic adenoma gene-like 1

192 Gene Product Result for
Synonyms: LOT1 ZAC ZAC1
Gene ID:
Human(5325) Summary: This gene encodes a C2H2 zinc finger protein with transactivation and DNA-binding activities. It has been shown to have anti-proliferative properties, and thus thought to function as a tumor suppressor. In addition, overexpression of this gene during fetal development is believed to underlie the rare disorder, transient neonatal diabetes mellitus (TNDM). This gene is imprinted, with preferential expression of the paternal allele in many tissues, however, biallelic expression has been noted in peripheral blood leucocytes. A recent study reports that tissue-specific imprinting results from variable utilization of monoallelic and biallelic promoters. Many transcript variants differing in the 5' UTR and encoding two different isoforms, have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(22634) pleiomorphic adenoma gene-like 1
Rat(25157) pleiomorphic adenoma gene-like 1
chicken(421664) pleiomorphic adenoma gene-like 1
dog(484018) pleiomorphic adenoma gene-like 1
domestic cat(101092436) pleiomorphic adenoma gene-like 1
naked mole-rat(101718544) pleiomorphic adenoma gene-like 1
domestic guinea pig(100735816) pleiomorphic adenoma gene-like 1
cow(539761) pleiomorphic adenoma gene-like 1
sheep(101119399) pleiomorphic adenoma gene-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079951 MISSION® esiRNA esiRNA human PLAGL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080951 Rosetta Predictions human pricing
NM_001080952 Rosetta Predictions human pricing
NM_001080953 Rosetta Predictions human pricing
NM_001080954 Rosetta Predictions human pricing
NM_001080955 Rosetta Predictions human pricing
NM_001080956 Rosetta Predictions human pricing
NM_002656 Rosetta Predictions human pricing
NM_006718 Rosetta Predictions human pricing
NM_012760 Rosetta Predictions rat pricing
NM_009538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316177 predicted 2141
2 SASI_Hs02_00316178 predicted 2329
3 SASI_Hs02_00316179 predicted 2440
4 SASI_Hs02_00316180 predicted 2335
5 SASI_Hs02_00316181 predicted 1574
6 SASI_Hs02_00316182 predicted 2392
7 SASI_Hs02_00316183 predicted 2445
8 SASI_Hs02_00316184 predicted 1732
9 SASI_Hs02_00316185 predicted 2253
10 SASI_Hs02_00316186 predicted 2360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316187 predicted 2276
2 SASI_Hs02_00316188 predicted 2470
3 SASI_Hs02_00316189 predicted 2580
4 SASI_Hs02_00316190 predicted 2471
5 SASI_Hs02_00316191 predicted 1724
6 SASI_Hs02_00316192 predicted 2527
7 SASI_Hs02_00316193 predicted 2584
8 SASI_Hs02_00316194 predicted 1878
9 SASI_Hs02_00316195 predicted 2393
10 SASI_Hs02_00316196 predicted 2508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316197 predicted 2232
2 SASI_Hs02_00316198 predicted 2422
3 SASI_Hs02_00316199 predicted 2542
4 SASI_Hs02_00316200 predicted 2430
5 SASI_Hs02_00316201 predicted 1674
6 SASI_Hs02_00316202 predicted 2481
7 SASI_Hs02_00316203 predicted 2540
8 SASI_Hs02_00316204 predicted 1832
9 SASI_Hs02_00316205 predicted 2351
10 SASI_Hs02_00316206 predicted 2455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316207 predicted 2228
2 SASI_Hs02_00316208 predicted 2425
3 SASI_Hs02_00316209 predicted 2533
4 SASI_Hs02_00316210 predicted 2430
5 SASI_Hs02_00316211 predicted 1668
6 SASI_Hs02_00316212 predicted 2486
7 SASI_Hs02_00316213 predicted 2531
8 SASI_Hs02_00316214 predicted 1831
9 SASI_Hs02_00316215 predicted 2346
10 SASI_Hs02_00316216 predicted 2460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316217 predicted 1586
2 SASI_Hs02_00316218 predicted 1780
3 SASI_Hs02_00316219 predicted 1892
4 SASI_Hs02_00316220 predicted 1781
5 SASI_Hs02_00316221 predicted 1032
6 SASI_Hs02_00316222 predicted 1840
7 SASI_Hs02_00316223 predicted 1892
8 SASI_Hs02_00316224 predicted 1179
9 SASI_Hs02_00316225 predicted 1704
10 SASI_Hs02_00316226 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316227 predicted 1768
2 SASI_Hs02_00316228 predicted 1958
3 SASI_Hs02_00316229 predicted 2079
4 SASI_Hs02_00316230 predicted 1971
5 SASI_Hs02_00316231 predicted 1216
6 SASI_Hs02_00316232 predicted 2022
7 SASI_Hs02_00316233 predicted 2076
8 SASI_Hs02_00316234 predicted 1365
9 SASI_Hs02_00316235 predicted 1890
10 SASI_Hs02_00316236 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190746 predicted 1804
2 SASI_Hs01_00190747 predicted 1997
3 SASI_Hs01_00190748 predicted 2111
4 SASI_Hs01_00190749 predicted 1998
5 SASI_Hs01_00190750 predicted 1240
6 SASI_Hs01_00190751 predicted 2052
7 SASI_Hs01_00190752 predicted 2107
8 SASI_Hs01_00190753 predicted 1400
9 SASI_Hs01_00190754 predicted 1920
10 SASI_Hs02_00334207 predicted 2032
11 SASI_Hs01_00190755 predicted 2844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083670 predicted 2264
2 SASI_Hs01_00083671 predicted 2458
3 SASI_Hs01_00083672 predicted 2574
4 SASI_Hs01_00083673 predicted 2460
5 SASI_Hs01_00083674 predicted 1705
6 SASI_Hs01_00083675 predicted 2518
7 SASI_Hs01_00083676 predicted 2573
8 SASI_Hs01_00083677 predicted 1866
9 SASI_Hs01_00083678 predicted 2378
10 SASI_Hs02_00342155 predicted 2489
11 SASI_Hs01_00083679 predicted 3302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090167 predicted 1444
2 SASI_Rn01_00090168 predicted 1662
3 SASI_Rn01_00090169 predicted 1643
4 SASI_Rn01_00090170 predicted 632
5 SASI_Rn01_00090171 predicted 1444
6 SASI_Rn01_00090172 predicted 747
7 SASI_Rn01_00090174 predicted 594
8 SASI_Rn01_00090175 predicted 688
9 SASI_Rn02_00260126 predicted 1264
10 SASI_Rn02_00260127 predicted 1322
11 SASI_Rn01_00090173 predicted 822
12 SASI_Rn01_00090176 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043815 predicted 684
2 SASI_Mm01_00043816 predicted 823
3 SASI_Mm01_00043817 predicted 1212
4 SASI_Mm01_00043818 predicted 733
5 SASI_Mm01_00043819 predicted 1043
6 SASI_Mm01_00043820 predicted 670
7 SASI_Mm01_00043821 predicted 1199
8 SASI_Mm01_00043822 predicted 697
9 SASI_Mm01_00043823 predicted 1332
10 SASI_Mm01_00043824 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002656
VALIDATED
PLAGL1 MISSION shRNA Bacterial Glycerol Stock
pleiomorphic adenoma gene-like 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-3144s1c1
Sequence:CCGGGCCTCATTTCCATCATGCATTCTCGAGAATGCATGATGGAAATGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002656.2-2733s1c1
Sequence:CCGGCAAAGCAGATACTAAAGGTTTCTCGAGAAACCTTTAGTATCTGCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002656.2-2256s1c1
Sequence:CCGGCCACTGTGAAAGATGCTTCTACTCGAGTAGAAGCATCTTTCACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-2463s1c1
Sequence:CCGGCTCGCCTTCATTCCAACTGAACTCGAGTTCAGTTGGAATGAAGGCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-1981s1c1
Sequence:CCGGGAGAAGACGTTCAACCGGAAACTCGAGTTTCCGGTTGAACGTCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1339s21c1
Sequence:CCGGACACCACTTCTACCTCATACTCTCGAGAGTATGAGGTAGAAGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-728s21c1
Sequence:CCGGCAACACCATGCTGGGCTATAACTCGAGTTATAGCCCAGCATGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1530s21c1
Sequence:CCGGGATGCTGTGAACCTAACAATACTCGAGTATTGTTAGGTTCACAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-1473s21c1
Sequence:GTACCGGTTTGATCTGGCTAAGGGAAATCTCGAGATTTCCCTTAGCCAGATCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1802s21c1
Sequence:CCGGCCATCATGCATTCAGATAATTCTCGAGAATTATCTGAATGCATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1104s21c1
Sequence:CCGGCACACCATCTCGCCTTCATTCCTCGAGGAATGAAGGCGAGATGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-829s21c1
Sequence:CCGGTGCTACTGGACCACCTCAAAGCTCGAGCTTTGAGGTGGTCCAGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-2660s21c1
Sequence:CCGGCTTTGCTCTGTCTAGCTTAAACTCGAGTTTAAGCTAGACAGAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-2120s21c1
Sequence:CCGGATCGTAAGCCATGATCATAATCTCGAGATTATGATCATGGCTTACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-1048s21c1
Sequence:CCGGACTCACAGGAGCTGATGAAAGCTCGAGCTTTCATCAGCTCCTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002656
VALIDATED
PLAGL1 MISSION shRNA shRNA Plasmid DNA
pleiomorphic adenoma gene-like 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-3144s1c1
Sequence:CCGGGCCTCATTTCCATCATGCATTCTCGAGAATGCATGATGGAAATGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002656.2-2733s1c1
Sequence:CCGGCAAAGCAGATACTAAAGGTTTCTCGAGAAACCTTTAGTATCTGCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002656.2-2256s1c1
Sequence:CCGGCCACTGTGAAAGATGCTTCTACTCGAGTAGAAGCATCTTTCACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-2463s1c1
Sequence:CCGGCTCGCCTTCATTCCAACTGAACTCGAGTTCAGTTGGAATGAAGGCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-1981s1c1
Sequence:CCGGGAGAAGACGTTCAACCGGAAACTCGAGTTTCCGGTTGAACGTCTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1339s21c1
Sequence:CCGGACACCACTTCTACCTCATACTCTCGAGAGTATGAGGTAGAAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-728s21c1
Sequence:CCGGCAACACCATGCTGGGCTATAACTCGAGTTATAGCCCAGCATGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1530s21c1
Sequence:CCGGGATGCTGTGAACCTAACAATACTCGAGTATTGTTAGGTTCACAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-1473s21c1
Sequence:GTACCGGTTTGATCTGGCTAAGGGAAATCTCGAGATTTCCCTTAGCCAGATCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1802s21c1
Sequence:CCGGCCATCATGCATTCAGATAATTCTCGAGAATTATCTGAATGCATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1104s21c1
Sequence:CCGGCACACCATCTCGCCTTCATTCCTCGAGGAATGAAGGCGAGATGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-829s21c1
Sequence:CCGGTGCTACTGGACCACCTCAAAGCTCGAGCTTTGAGGTGGTCCAGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-2660s21c1
Sequence:CCGGCTTTGCTCTGTCTAGCTTAAACTCGAGTTTAAGCTAGACAGAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-2120s21c1
Sequence:CCGGATCGTAAGCCATGATCATAATCTCGAGATTATGATCATGGCTTACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-1048s21c1
Sequence:CCGGACTCACAGGAGCTGATGAAAGCTCGAGCTTTCATCAGCTCCTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002656
VALIDATED
PLAGL1 MISSION shRNA Lentiviral Transduction Particles
pleiomorphic adenoma gene-like 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-3144s1c1
Sequence:CCGGGCCTCATTTCCATCATGCATTCTCGAGAATGCATGATGGAAATGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002656.2-2733s1c1
Sequence:CCGGCAAAGCAGATACTAAAGGTTTCTCGAGAAACCTTTAGTATCTGCTTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002656.2-2256s1c1
Sequence:CCGGCCACTGTGAAAGATGCTTCTACTCGAGTAGAAGCATCTTTCACAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-2463s1c1
Sequence:CCGGCTCGCCTTCATTCCAACTGAACTCGAGTTCAGTTGGAATGAAGGCGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002656.2-1981s1c1
Sequence:CCGGGAGAAGACGTTCAACCGGAAACTCGAGTTTCCGGTTGAACGTCTTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1339s21c1
Sequence:CCGGACACCACTTCTACCTCATACTCTCGAGAGTATGAGGTAGAAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-728s21c1
Sequence:CCGGCAACACCATGCTGGGCTATAACTCGAGTTATAGCCCAGCATGGTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1530s21c1
Sequence:CCGGGATGCTGTGAACCTAACAATACTCGAGTATTGTTAGGTTCACAGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-1473s21c1
Sequence:GTACCGGTTTGATCTGGCTAAGGGAAATCTCGAGATTTCCCTTAGCCAGATCAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1802s21c1
Sequence:CCGGCCATCATGCATTCAGATAATTCTCGAGAATTATCTGAATGCATGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002656.3-1104s21c1
Sequence:CCGGCACACCATCTCGCCTTCATTCCTCGAGGAATGAAGGCGAGATGGTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-829s21c1
Sequence:CCGGTGCTACTGGACCACCTCAAAGCTCGAGCTTTGAGGTGGTCCAGTAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-2660s21c1
Sequence:CCGGCTTTGCTCTGTCTAGCTTAAACTCGAGTTTAAGCTAGACAGAGCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-2120s21c1
Sequence:CCGGATCGTAAGCCATGATCATAATCTCGAGATTATGATCATGGCTTACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002656.3-1048s21c1
Sequence:CCGGACTCACAGGAGCTGATGAAAGCTCGAGCTTTCATCAGCTCCTGTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009538
VALIDATED
PLAGL1 MISSION shRNA Bacterial Glycerol Stock
pleiomorphic adenoma gene-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-2608s1c1
Sequence:CCGGGACGCTATTGATGTCTCCATTCTCGAGAATGGAGACATCAATAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1197s1c1
Sequence:CCGGCCAGAGCAATTTCCAACTCATCTCGAGATGAGTTGGAAATTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1732s1c1
Sequence:CCGGCCAATTATTCTTCAGGAGCATCTCGAGATGCTCCTGAAGAATAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009538.1-1198s1c1
Sequence:CCGGCAGAGCAATTTCCAACTCATTCTCGAGAATGAGTTGGAAATTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1011s1c1
Sequence:CCGGCCACTGTGATAGATGCTTCTACTCGAGTAGAAGCATCTATCACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009538
VALIDATED
PLAGL1 MISSION shRNA shRNA Plasmid DNA
pleiomorphic adenoma gene-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-2608s1c1
Sequence:CCGGGACGCTATTGATGTCTCCATTCTCGAGAATGGAGACATCAATAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1197s1c1
Sequence:CCGGCCAGAGCAATTTCCAACTCATCTCGAGATGAGTTGGAAATTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1732s1c1
Sequence:CCGGCCAATTATTCTTCAGGAGCATCTCGAGATGCTCCTGAAGAATAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009538.1-1198s1c1
Sequence:CCGGCAGAGCAATTTCCAACTCATTCTCGAGAATGAGTTGGAAATTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1011s1c1
Sequence:CCGGCCACTGTGATAGATGCTTCTACTCGAGTAGAAGCATCTATCACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009538
VALIDATED
PLAGL1 MISSION shRNA Lentiviral Transduction Particles
pleiomorphic adenoma gene-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-2608s1c1
Sequence:CCGGGACGCTATTGATGTCTCCATTCTCGAGAATGGAGACATCAATAGCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1197s1c1
Sequence:CCGGCCAGAGCAATTTCCAACTCATCTCGAGATGAGTTGGAAATTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1732s1c1
Sequence:CCGGCCAATTATTCTTCAGGAGCATCTCGAGATGCTCCTGAAGAATAATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009538.1-1198s1c1
Sequence:CCGGCAGAGCAATTTCCAACTCATTCTCGAGAATGAGTTGGAAATTGCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009538.1-1011s1c1
Sequence:CCGGCCACTGTGATAGATGCTTCTACTCGAGTAGAAGCATCTATCACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)