EMAIL THIS PAGE TO A FRIEND

PLAGL2

pleiomorphic adenoma gene-like 2

291 Gene Product Result for
Synonyms: ZNF900
UniProtKB ID: Q9UPG8, A8K8T5, E1P5M3, Q92584
Gene ID:
Human(5326) Summary: Pleiomorphic adenoma gene-like 2 is a zinc-finger protein that recognizes DNA and/or RNA. [provided by RefSeq, Jul 2008]
Mouse(54711) pleiomorphic adenoma gene-like 2
Rat(296281) pleiomorphic adenoma gene-like 2
cow(522566) pleiomorphic adenoma gene-like 2
sheep(101103746) pleiomorphic adenoma gene-like 2
domestic guinea pig(100724504) pleiomorphic adenoma gene-like 2
Zebrafish(259255) pleiomorphic adenoma gene-like 2
chicken(419283) pleiomorphic adenoma gene-like 2
Horse(100053794) pleiomorphic adenoma gene-like 2
domestic cat(101094583) pleiomorphic adenoma gene-like 2
dog(485829) pleiomorphic adenoma gene-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110321 MISSION® esiRNA esiRNA human PLAGL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002657 Rosetta Predictions human pricing
NM_001106528 Rosetta Predictions rat pricing
NM_018807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120936 predicted 823
2 SASI_Hs01_00120937 predicted 1273
3 SASI_Hs01_00120938 predicted 1084
4 SASI_Hs01_00120939 predicted 509
5 SASI_Hs01_00120940 predicted 811
6 SASI_Hs01_00120941 predicted 1248
7 SASI_Hs01_00120942 predicted 1249
8 SASI_Hs01_00120943 predicted 613
9 SASI_Hs01_00120944 predicted 1175
10 SASI_Hs01_00120945 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219848 predicted 1064
2 SASI_Rn02_00219849 predicted 924
3 SASI_Rn02_00219850 predicted 1116
4 SASI_Rn02_00219851 predicted 1126
5 SASI_Rn02_00219852 predicted 743
6 SASI_Rn02_00219853 predicted 794
7 SASI_Rn02_00219854 predicted 802
8 SASI_Rn02_00219855 predicted 1213
9 SASI_Rn02_00219856 predicted 1158
10 SASI_Rn02_00219857 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194269 predicted 1062
2 SASI_Mm01_00194270 predicted 1161
3 SASI_Mm01_00194271 predicted 1547
4 SASI_Mm01_00194272 predicted 1254
5 SASI_Mm01_00194273 predicted 1654
6 SASI_Mm01_00194274 predicted 1231
7 SASI_Mm01_00194275 predicted 866
8 SASI_Mm01_00194276 predicted 500
9 SASI_Mm01_00194277 predicted 295
10 SASI_Mm02_00324146 predicted 591
11 SASI_Mm01_00194268 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002657
PLAGL2 MISSION shRNA Bacterial Glycerol Stock
pleiomorphic adenoma gene-like 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-1925s21c1
Sequence:CCGGCCGTAGGACTTCAGGTATTATCTCGAGATAATACCTGAAGTCCTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-2067s21c1
Sequence:CCGGTTGGATGACCTCTAGAGAAATCTCGAGATTTCTCTAGAGGTCATCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-1682s21c1
Sequence:CCGGCCTCGTTTCCATCAAGCATTCCTCGAGGAATGCTTGATGGAAACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-519s21c1
Sequence:CCGGTGTACTGTGATAAGATGTTTCCTCGAGGAAACATCTTATCACAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-2198s21c1
Sequence:CCGGGCAGGAGAGAAGGCCTTTATTCTCGAGAATAAAGGCCTTCTCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-570s21c1
Sequence:CCGGAGACCCATGATCCTAACAAAGCTCGAGCTTTGTTAGGATCATGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-1862s21c1
Sequence:CCGGTTCAGGCTCTAGGATCGATTCCTCGAGGAATCGATCCTAGAGCCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-598s1c1
Sequence:CCGGCGGTAAGAATTACAATACGAACTCGAGTTCGTATTGTAATTCTTACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-440s1c1
Sequence:CCGGGCTTCCAAATACAAGCTGTATCTCGAGATACAGCTTGTATTTGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002657.2-4386s1c1
Sequence:CCGGGCCTGGTTGTTCAAAGGATAACTCGAGTTATCCTTTGAACAACCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-1231s1c1
Sequence:CCGGGCTTGGATCTACCTCATACTTCTCGAGAAGTATGAGGTAGATCCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-797s1c1
Sequence:CCGGCGGTTCTATACTCGTAAGGATCTCGAGATCCTTACGAGTATAGAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002657
PLAGL2 MISSION shRNA shRNA Plasmid DNA
pleiomorphic adenoma gene-like 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-1925s21c1
Sequence:CCGGCCGTAGGACTTCAGGTATTATCTCGAGATAATACCTGAAGTCCTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-2067s21c1
Sequence:CCGGTTGGATGACCTCTAGAGAAATCTCGAGATTTCTCTAGAGGTCATCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-1682s21c1
Sequence:CCGGCCTCGTTTCCATCAAGCATTCCTCGAGGAATGCTTGATGGAAACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-519s21c1
Sequence:CCGGTGTACTGTGATAAGATGTTTCCTCGAGGAAACATCTTATCACAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-2198s21c1
Sequence:CCGGGCAGGAGAGAAGGCCTTTATTCTCGAGAATAAAGGCCTTCTCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-570s21c1
Sequence:CCGGAGACCCATGATCCTAACAAAGCTCGAGCTTTGTTAGGATCATGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-1862s21c1
Sequence:CCGGTTCAGGCTCTAGGATCGATTCCTCGAGGAATCGATCCTAGAGCCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-598s1c1
Sequence:CCGGCGGTAAGAATTACAATACGAACTCGAGTTCGTATTGTAATTCTTACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-440s1c1
Sequence:CCGGGCTTCCAAATACAAGCTGTATCTCGAGATACAGCTTGTATTTGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002657.2-4386s1c1
Sequence:CCGGGCCTGGTTGTTCAAAGGATAACTCGAGTTATCCTTTGAACAACCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-1231s1c1
Sequence:CCGGGCTTGGATCTACCTCATACTTCTCGAGAAGTATGAGGTAGATCCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-797s1c1
Sequence:CCGGCGGTTCTATACTCGTAAGGATCTCGAGATCCTTACGAGTATAGAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002657
PLAGL2 MISSION shRNA Lentiviral Transduction Particles
pleiomorphic adenoma gene-like 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-1925s21c1
Sequence:CCGGCCGTAGGACTTCAGGTATTATCTCGAGATAATACCTGAAGTCCTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-2067s21c1
Sequence:CCGGTTGGATGACCTCTAGAGAAATCTCGAGATTTCTCTAGAGGTCATCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-1682s21c1
Sequence:CCGGCCTCGTTTCCATCAAGCATTCCTCGAGGAATGCTTGATGGAAACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-519s21c1
Sequence:CCGGTGTACTGTGATAAGATGTTTCCTCGAGGAAACATCTTATCACAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-2198s21c1
Sequence:CCGGGCAGGAGAGAAGGCCTTTATTCTCGAGAATAAAGGCCTTCTCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002657.3-570s21c1
Sequence:CCGGAGACCCATGATCCTAACAAAGCTCGAGCTTTGTTAGGATCATGGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002657.3-1862s21c1
Sequence:CCGGTTCAGGCTCTAGGATCGATTCCTCGAGGAATCGATCCTAGAGCCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-598s1c1
Sequence:CCGGCGGTAAGAATTACAATACGAACTCGAGTTCGTATTGTAATTCTTACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-440s1c1
Sequence:CCGGGCTTCCAAATACAAGCTGTATCTCGAGATACAGCTTGTATTTGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002657.2-4386s1c1
Sequence:CCGGGCCTGGTTGTTCAAAGGATAACTCGAGTTATCCTTTGAACAACCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-1231s1c1
Sequence:CCGGGCTTGGATCTACCTCATACTTCTCGAGAAGTATGAGGTAGATCCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002657.2-797s1c1
Sequence:CCGGCGGTTCTATACTCGTAAGGATCTCGAGATCCTTACGAGTATAGAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018807
VALIDATED
PLAGL2 MISSION shRNA Bacterial Glycerol Stock
pleiomorphic adenoma gene-like 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-382s21c1
Sequence:CCGGTCCGGAGCAGAGACCATATAGCTCGAGCTATATGGTCTCTGCTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1236s21c1
Sequence:CCGGCCTCATACTTGCCCGACAAACCTCGAGGTTTGTCGGGCAAGTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-435s21c1
Sequence:CCGGCCTCCAAGTACAAGCTGTATACTCGAGTATACAGCTTGTACTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-780s21c1
Sequence:CCGGATTGTGACAGGCGGTTCTATACTCGAGTATAGAACCGCCTGTCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1151s21c1
Sequence:CCGGCTGCCCATGGGTATGAGTTACCTCGAGGTAACTCATACCCATGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-691s21c1
Sequence:CCGGTGAGAGTACCCAGGCCCTATTCTCGAGAATAGGGCCTGGGTACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018807.4-434s1c1
Sequence:CCGGGCCTCCAAGTACAAGCTGTATCTCGAGATACAGCTTGTACTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-791s1c1
Sequence:CCGGCGGTTCTATACTCGGAAGGATCTCGAGATCCTTCCGAGTATAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-582s1c1
Sequence:CCGGGCTCTGAGTGTGGTAAGAATTCTCGAGAATTCTTACCACACTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-982s21c1
Sequence:CCGGTAGCTCTACAGTCAGTGTAAACTCGAGTTTACACTGACTGTAGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018807.5-1933s21c1
Sequence:CCGGATCTGAACTGGGAGCTATATTCTCGAGAATATAGCTCCCAGTTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-585s21c1
Sequence:CCGGCTGAGTGTGGTAAGAATTATACTCGAGTATAATTCTTACCACACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1071s21c1
Sequence:CCGGTGTTGCCCATGGGTATGTATGCTCGAGCATACATACCCATGGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-4129s1c1
Sequence:CCGGGCTGGTTATCTGCCTTCAATTCTCGAGAATTGAAGGCAGATAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-952s1c1
Sequence:CCGGGCCAGTGGATATGTTAGGCTTCTCGAGAAGCCTAACATATCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018807
VALIDATED
PLAGL2 MISSION shRNA shRNA Plasmid DNA
pleiomorphic adenoma gene-like 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-382s21c1
Sequence:CCGGTCCGGAGCAGAGACCATATAGCTCGAGCTATATGGTCTCTGCTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1236s21c1
Sequence:CCGGCCTCATACTTGCCCGACAAACCTCGAGGTTTGTCGGGCAAGTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-435s21c1
Sequence:CCGGCCTCCAAGTACAAGCTGTATACTCGAGTATACAGCTTGTACTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-780s21c1
Sequence:CCGGATTGTGACAGGCGGTTCTATACTCGAGTATAGAACCGCCTGTCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1151s21c1
Sequence:CCGGCTGCCCATGGGTATGAGTTACCTCGAGGTAACTCATACCCATGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-691s21c1
Sequence:CCGGTGAGAGTACCCAGGCCCTATTCTCGAGAATAGGGCCTGGGTACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018807.4-434s1c1
Sequence:CCGGGCCTCCAAGTACAAGCTGTATCTCGAGATACAGCTTGTACTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-791s1c1
Sequence:CCGGCGGTTCTATACTCGGAAGGATCTCGAGATCCTTCCGAGTATAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-582s1c1
Sequence:CCGGGCTCTGAGTGTGGTAAGAATTCTCGAGAATTCTTACCACACTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-982s21c1
Sequence:CCGGTAGCTCTACAGTCAGTGTAAACTCGAGTTTACACTGACTGTAGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018807.5-1933s21c1
Sequence:CCGGATCTGAACTGGGAGCTATATTCTCGAGAATATAGCTCCCAGTTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-585s21c1
Sequence:CCGGCTGAGTGTGGTAAGAATTATACTCGAGTATAATTCTTACCACACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1071s21c1
Sequence:CCGGTGTTGCCCATGGGTATGTATGCTCGAGCATACATACCCATGGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-4129s1c1
Sequence:CCGGGCTGGTTATCTGCCTTCAATTCTCGAGAATTGAAGGCAGATAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-952s1c1
Sequence:CCGGGCCAGTGGATATGTTAGGCTTCTCGAGAAGCCTAACATATCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018807
VALIDATED
PLAGL2 MISSION shRNA Lentiviral Transduction Particles
pleiomorphic adenoma gene-like 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-382s21c1
Sequence:CCGGTCCGGAGCAGAGACCATATAGCTCGAGCTATATGGTCTCTGCTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1236s21c1
Sequence:CCGGCCTCATACTTGCCCGACAAACCTCGAGGTTTGTCGGGCAAGTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-435s21c1
Sequence:CCGGCCTCCAAGTACAAGCTGTATACTCGAGTATACAGCTTGTACTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-780s21c1
Sequence:CCGGATTGTGACAGGCGGTTCTATACTCGAGTATAGAACCGCCTGTCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1151s21c1
Sequence:CCGGCTGCCCATGGGTATGAGTTACCTCGAGGTAACTCATACCCATGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-691s21c1
Sequence:CCGGTGAGAGTACCCAGGCCCTATTCTCGAGAATAGGGCCTGGGTACTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018807.4-434s1c1
Sequence:CCGGGCCTCCAAGTACAAGCTGTATCTCGAGATACAGCTTGTACTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-791s1c1
Sequence:CCGGCGGTTCTATACTCGGAAGGATCTCGAGATCCTTCCGAGTATAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-582s1c1
Sequence:CCGGGCTCTGAGTGTGGTAAGAATTCTCGAGAATTCTTACCACACTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-982s21c1
Sequence:CCGGTAGCTCTACAGTCAGTGTAAACTCGAGTTTACACTGACTGTAGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018807.5-1933s21c1
Sequence:CCGGATCTGAACTGGGAGCTATATTCTCGAGAATATAGCTCCCAGTTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-585s21c1
Sequence:CCGGCTGAGTGTGGTAAGAATTATACTCGAGTATAATTCTTACCACACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018807.5-1071s21c1
Sequence:CCGGTGTTGCCCATGGGTATGTATGCTCGAGCATACATACCCATGGGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-4129s1c1
Sequence:CCGGGCTGGTTATCTGCCTTCAATTCTCGAGAATTGAAGGCAGATAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018807.4-952s1c1
Sequence:CCGGGCCAGTGGATATGTTAGGCTTCTCGAGAAGCCTAACATATCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)