EMAIL THIS PAGE TO A FRIEND

PLAT

plasminogen activator, tissue

87 Gene Product Result for
Synonyms: T-PA TPA
Gene ID:
Human(5327) Summary: This gene encodes tissue-type plasminogen activator, a secreted serine protease which converts the proenzyme plasminogen to plasmin, a fibrinolytic enzyme. Tissue-type plasminogen activator is synthesized as a single chain which is cleaved by plasmin to a two chain disulfide linked protein. This enzyme plays a role in cell migration and tissue remodeling. Increased enzymatic activity causes hyperfibrinolysis, which manifests as excessive bleeding; decreased activity leads to hypofibrinolysis which can result in thrombosis or embolism. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(18791) plasminogen activator, tissue
Rat(25692) plasminogen activator, tissue
cow(281407) plasminogen activator, tissue
sheep(101118332) plasminogen activator, tissue
domestic guinea pig(100725281) plasminogen activator, tissue
naked mole-rat(101713266) plasminogen activator, tissue
Domestic Rabbit(100009556) plasminogen activator, tissue
Zebrafish(100320028) plasminogen activator, tissue
dog(482840) plasminogen activator, tissue
Horse(100050239) plasminogen activator, tissue
domestic cat(101100299) plasminogen activator, tissue
chicken(426791) plasminogen activator, tissue
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
12072 Benzamidine ≥95.0% human pricing
76308 Pefabloc® TH acetate salt, ≥90% (HPLC) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1752 Human TPA ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000930 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000930 Rosetta Predictions human pricing
NM_000931 Rosetta Predictions human pricing
NM_033011 Rosetta Predictions human pricing
NM_013151 Rosetta Predictions rat pricing
NM_008872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303522 predicted 1957
2 SASI_Hs02_00303523 predicted 1393
3 SASI_Hs02_00303524 predicted 915
4 SASI_Hs02_00303525 predicted 1361
5 SASI_Hs02_00303526 predicted 1351
6 SASI_Hs02_00303527 predicted 1633
7 SASI_Hs02_00303528 predicted 1401
8 SASI_Hs02_00303529 predicted 927
9 SASI_Hs01_00167674 predicted 731
10 SASI_Hs02_00303530 predicted 1629
11 SASI_Hs01_00167667 predicted 1973
12 SASI_Hs01_00167668 predicted 2328
13 SASI_Hs01_00167669 predicted 1777
14 SASI_Hs01_00167670 predicted 1834
15 SASI_Hs01_00167671 predicted 2292
16 SASI_Hs01_00167672 predicted 753
17 SASI_Hs01_00167673 predicted 2253
18 SASI_Hs01_00167675 predicted 2135
19 SASI_Hs01_00167676 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222995 predicted 1452
2 SASI_Hs01_00222996 predicted 1443
3 SASI_Hs01_00222997 predicted 1268
4 SASI_Hs01_00222998 predicted 1328
5 SASI_Hs01_00222999 predicted 759
6 SASI_Hs01_00223000 predicted 738
7 SASI_Hs01_00223001 predicted 1346
8 SASI_Hs01_00223002 predicted 1385
9 SASI_Hs01_00223003 predicted 1569
10 SASI_Hs01_00223004 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360673 predicted 1816
2 SASI_Hs02_00360674 predicted 1254
3 SASI_Hs02_00360675 predicted 782
4 SASI_Hs02_00360676 predicted 1221
5 SASI_Hs02_00360677 predicted 1222
6 SASI_Hs02_00360678 predicted 1494
7 SASI_Hs02_00360679 predicted 1269
8 SASI_Hs02_00360680 predicted 787
9 SASI_Hs01_00047647 predicted 598
10 SASI_Hs02_00360681 predicted 1494
11 SASI_Hs01_00047640 predicted 1834
12 SASI_Hs01_00047641 predicted 2184
13 SASI_Hs01_00047642 predicted 1635
14 SASI_Hs01_00047643 predicted 1701
15 SASI_Hs01_00047644 predicted 2163
16 SASI_Hs01_00047645 predicted 622
17 SASI_Hs01_00047646 predicted 2115
18 SASI_Hs01_00047648 predicted 1991
19 SASI_Hs01_00047649 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039845 predicted 1738
2 SASI_Rn01_00039846 predicted 1006
3 SASI_Rn01_00039847 predicted 681
4 SASI_Rn01_00039848 predicted 443
5 SASI_Rn01_00039849 predicted 529
6 SASI_Rn01_00039850 predicted 671
7 SASI_Rn01_00039852 predicted 434
8 SASI_Rn02_00260958 predicted 532
9 SASI_Rn01_00039853 predicted 1506
10 SASI_Rn01_00039854 predicted 1043
11 SASI_Rn01_00039851 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099724 predicted 1287
2 SASI_Mm01_00099725 predicted 1663
3 SASI_Mm01_00099726 predicted 739
4 SASI_Mm01_00099727 predicted 1748
5 SASI_Mm01_00099728 predicted 736
6 SASI_Mm01_00099729 predicted 1007
7 SASI_Mm01_00099730 predicted 1668
8 SASI_Mm01_00099731 predicted 683
9 SASI_Mm01_00099732 predicted 1055
10 SASI_Mm01_00099733 predicted 1729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008872
VALIDATED
PLAT MISSION shRNA Bacterial Glycerol Stock
plasminogen activator, tissue
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008872.1-874s1c1
Sequence:CCGGCGACACAATTATTGTCGGAATCTCGAGATTCCGACAATAATTGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008872.1-414s1c1
Sequence:CCGGCCCTGATGGATTTGTAGGGAACTCGAGTTCCCTACAAATCCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1287s1c1
Sequence:CCGGCGATACTTATGACAACGACATCTCGAGATGTCGTTGTCATAAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1654s1c1
Sequence:CCGGCAGATGACATTGACTGGCATTCTCGAGAATGCCAGTCAATGTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1003s1c1
Sequence:CCGGCGGCCTCAGTTTAGAATTAAACTCGAGTTTAATTCTAAACTGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008872.2-1293s21c1
Sequence:CCGGGAATTTGATGACGATACTTATCTCGAGATAAGTATCGTCATCAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-1671s21c1
Sequence:CCGGCAGATGACATTGACTGGCATTCTCGAGAATGCCAGTCAATGTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-568s21c1
Sequence:CCGGTGTCGCTGAAGCCCTACAATGCTCGAGCATTGTAGGGCTTCAGCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008872.2-1649s21c1
Sequence:CCGGTCTGGTGTGCATGATCAATAACTCGAGTTATTGATCATGCACACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-2260s21c1
Sequence:CCGGGCCGAATCACAGCACCATAAACTCGAGTTTATGGTGCTGTGATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008872
VALIDATED
PLAT MISSION shRNA shRNA Plasmid DNA
plasminogen activator, tissue
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008872.1-874s1c1
Sequence:CCGGCGACACAATTATTGTCGGAATCTCGAGATTCCGACAATAATTGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008872.1-414s1c1
Sequence:CCGGCCCTGATGGATTTGTAGGGAACTCGAGTTCCCTACAAATCCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1287s1c1
Sequence:CCGGCGATACTTATGACAACGACATCTCGAGATGTCGTTGTCATAAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1654s1c1
Sequence:CCGGCAGATGACATTGACTGGCATTCTCGAGAATGCCAGTCAATGTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1003s1c1
Sequence:CCGGCGGCCTCAGTTTAGAATTAAACTCGAGTTTAATTCTAAACTGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008872.2-1293s21c1
Sequence:CCGGGAATTTGATGACGATACTTATCTCGAGATAAGTATCGTCATCAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-1671s21c1
Sequence:CCGGCAGATGACATTGACTGGCATTCTCGAGAATGCCAGTCAATGTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-568s21c1
Sequence:CCGGTGTCGCTGAAGCCCTACAATGCTCGAGCATTGTAGGGCTTCAGCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008872.2-1649s21c1
Sequence:CCGGTCTGGTGTGCATGATCAATAACTCGAGTTATTGATCATGCACACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-2260s21c1
Sequence:CCGGGCCGAATCACAGCACCATAAACTCGAGTTTATGGTGCTGTGATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008872
VALIDATED
PLAT MISSION shRNA Lentiviral Transduction Particles
plasminogen activator, tissue
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008872.1-874s1c1
Sequence:CCGGCGACACAATTATTGTCGGAATCTCGAGATTCCGACAATAATTGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008872.1-414s1c1
Sequence:CCGGCCCTGATGGATTTGTAGGGAACTCGAGTTCCCTACAAATCCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1287s1c1
Sequence:CCGGCGATACTTATGACAACGACATCTCGAGATGTCGTTGTCATAAGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1654s1c1
Sequence:CCGGCAGATGACATTGACTGGCATTCTCGAGAATGCCAGTCAATGTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008872.1-1003s1c1
Sequence:CCGGCGGCCTCAGTTTAGAATTAAACTCGAGTTTAATTCTAAACTGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008872.2-1293s21c1
Sequence:CCGGGAATTTGATGACGATACTTATCTCGAGATAAGTATCGTCATCAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-1671s21c1
Sequence:CCGGCAGATGACATTGACTGGCATTCTCGAGAATGCCAGTCAATGTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-568s21c1
Sequence:CCGGTGTCGCTGAAGCCCTACAATGCTCGAGCATTGTAGGGCTTCAGCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008872.2-1649s21c1
Sequence:CCGGTCTGGTGTGCATGATCAATAACTCGAGTTATTGATCATGCACACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008872.2-2260s21c1
Sequence:CCGGGCCGAATCACAGCACCATAAACTCGAGTTTATGGTGCTGTGATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000930
VALIDATED
PLAT MISSION shRNA Bacterial Glycerol Stock
plasminogen activator, tissue
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-1630s1c1
Sequence:CCGGCCGCTGCACATCACAACATTTCTCGAGAAATGTTGTGATGTGCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-551s1c1
Sequence:CCGGGCTGGGAAGTGCTGTGAAATACTCGAGTATTTCACAGCACTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-1864s1c1
Sequence:CCGGCCTAGACTGGATTCGTGACAACTCGAGTTGTCACGAATCCAGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-347s1c1
Sequence:CCGGCAGATGATATACCAGCAACATCTCGAGATGTTGCTGGTATATCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-946s1c1
Sequence:CCGGCAAGGTTTACACAGCACAGAACTCGAGTTCTGTGCTGTGTAAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-348s21c1
Sequence:CCGGCAGATGATATACCAGCAACATCTCGAGATGTTGCTGGTATATCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-947s21c1
Sequence:CCGGCAAGGTTTACACAGCACAGAACTCGAGTTCTGTGCTGTGTAAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-1865s21c1
Sequence:CCGGCCTAGACTGGATTCGTGACAACTCGAGTTGTCACGAATCCAGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-552s21c1
Sequence:CCGGGCTGGGAAGTGCTGTGAAATACTCGAGTATTTCACAGCACTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000930
VALIDATED
PLAT MISSION shRNA shRNA Plasmid DNA
plasminogen activator, tissue
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-1630s1c1
Sequence:CCGGCCGCTGCACATCACAACATTTCTCGAGAAATGTTGTGATGTGCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-551s1c1
Sequence:CCGGGCTGGGAAGTGCTGTGAAATACTCGAGTATTTCACAGCACTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-1864s1c1
Sequence:CCGGCCTAGACTGGATTCGTGACAACTCGAGTTGTCACGAATCCAGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-347s1c1
Sequence:CCGGCAGATGATATACCAGCAACATCTCGAGATGTTGCTGGTATATCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-946s1c1
Sequence:CCGGCAAGGTTTACACAGCACAGAACTCGAGTTCTGTGCTGTGTAAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-348s21c1
Sequence:CCGGCAGATGATATACCAGCAACATCTCGAGATGTTGCTGGTATATCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-947s21c1
Sequence:CCGGCAAGGTTTACACAGCACAGAACTCGAGTTCTGTGCTGTGTAAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-1865s21c1
Sequence:CCGGCCTAGACTGGATTCGTGACAACTCGAGTTGTCACGAATCCAGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-552s21c1
Sequence:CCGGGCTGGGAAGTGCTGTGAAATACTCGAGTATTTCACAGCACTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000930
VALIDATED
PLAT MISSION shRNA Lentiviral Transduction Particles
plasminogen activator, tissue
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-1630s1c1
Sequence:CCGGCCGCTGCACATCACAACATTTCTCGAGAAATGTTGTGATGTGCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-551s1c1
Sequence:CCGGGCTGGGAAGTGCTGTGAAATACTCGAGTATTTCACAGCACTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-1864s1c1
Sequence:CCGGCCTAGACTGGATTCGTGACAACTCGAGTTGTCACGAATCCAGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-347s1c1
Sequence:CCGGCAGATGATATACCAGCAACATCTCGAGATGTTGCTGGTATATCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000930.2-946s1c1
Sequence:CCGGCAAGGTTTACACAGCACAGAACTCGAGTTCTGTGCTGTGTAAACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-348s21c1
Sequence:CCGGCAGATGATATACCAGCAACATCTCGAGATGTTGCTGGTATATCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-947s21c1
Sequence:CCGGCAAGGTTTACACAGCACAGAACTCGAGTTCTGTGCTGTGTAAACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-1865s21c1
Sequence:CCGGCCTAGACTGGATTCGTGACAACTCGAGTTGTCACGAATCCAGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000930.3-552s21c1
Sequence:CCGGGCTGGGAAGTGCTGTGAAATACTCGAGTATTTCACAGCACTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)