EMAIL THIS PAGE TO A FRIEND

PLAU

plasminogen activator, urokinase

204 Gene Product Result for
Synonyms: ATF BDPLT5 QPD UPA URK u-PA
Gene ID:
Human(5328) Summary: This gene encodes a serine protease involved in degradation of the extracellular matrix and possibly tumor cell migration and proliferation. A specific polymorphism in this gene may be associated with late-onset Alzheimer's disease and also with decreased affinity for fibrin-binding. This protein converts plasminogen to plasmin by specific cleavage of an Arg-Val bond in plasminogen. Plasmin in turn cleaves this protein at a Lys-Ile bond to form a two-chain derivative in which a single disulfide bond connects the amino-terminal A-chain to the catalytically active, carboxy-terminal B-chain. This two-chain derivative is also called HMW-uPA (high molecular weight uPA). HMW-uPA can be further processed into LMW-uPA (low molecular weight uPA) by cleavage of chain A into a short chain A (A1) and an amino-terminal fragment. LMW-uPA is proteolytically active but does not bind to the uPA receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(18792) plasminogen activator, urokinase
Rat(25619) plasminogen activator, urokinase
chicken(396424) plasminogen activator, urokinase
domestic cat(101098338) plasminogen activator, urokinase
dog(403426) plasminogen activator, urokinase
Domestic Rabbit(100008633) plasminogen activator, urokinase
naked mole-rat(101717852) plasminogen activator, urokinase
domestic guinea pig(100726129) plasminogen activator, urokinase
cow(281408) plasminogen activator, urokinase
sheep(100302501) plasminogen activator, urokinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
171778 2-Aminobenzimidazole 97% human pricing
12072 Benzamidine ≥95.0% human pricing
A7410 Amiloride hydrochloride hydrate ≥98% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015561 MISSION® esiRNA esiRNA targeting human PLAU (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002658 Rosetta Predictions human pricing
NM_013085 Rosetta Predictions rat pricing
XM_579368 Rosetta Predictions rat pricing
NM_008873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334208 predicted 213
2 SASI_Hs01_00111049 predicted 1052
3 SASI_Hs01_00111050 predicted 529
4 SASI_Hs02_00334209 predicted 861
5 SASI_Hs01_00111051 predicted 521
6 SASI_Hs01_00111053 predicted 220
7 SASI_Hs01_00111054 predicted 839
8 SASI_Hs01_00111055 predicted 221
9 SASI_Hs01_00111056 predicted 300
10 SASI_Hs01_00111057 predicted 248
11 SASI_Hs01_00111052 predicted 239
12 SASI_Hs01_00111058 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045900 predicted 1110
2 SASI_Rn01_00045901 predicted 1033
3 SASI_Rn01_00045902 predicted 969
4 SASI_Rn02_00260851 predicted 340
5 SASI_Rn01_00045904 predicted 1186
6 SASI_Rn02_00260852 predicted 294
7 SASI_Rn02_00260853 predicted 377
8 SASI_Rn01_00045905 predicted 459
9 SASI_Rn01_00045906 predicted 1309
10 SASI_Rn01_00045907 predicted 538
11 SASI_Rn01_00045903 predicted 219
12 SASI_Rn01_00045908 predicted 1243
13 SASI_Rn01_00045909 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192917 predicted 399
2 SASI_Rn01_00192918 predicted 775
3 SASI_Rn01_00192919 predicted 388
4 SASI_Rn01_00192920 predicted 890
5 SASI_Rn01_00192921 predicted 404
6 SASI_Rn01_00192922 predicted 420
7 SASI_Rn01_00192923 predicted 508
8 SASI_Rn01_00192924 predicted 586
9 SASI_Rn01_00192925 predicted 785
10 SASI_Rn01_00192926 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138850 predicted 258
2 SASI_Mm01_00138852 predicted 999
3 SASI_Mm01_00138853 predicted 1028
4 SASI_Mm01_00138854 predicted 268
5 SASI_Mm02_00314859 predicted 797
6 SASI_Mm01_00138855 predicted 237
7 SASI_Mm01_00138857 predicted 1107
8 SASI_Mm01_00138858 predicted 1316
9 SASI_Mm01_00138859 predicted 465
10 SASI_Mm02_00314860 predicted 1070
11 SASI_Mm01_00138851 predicted 741
12 SASI_Mm01_00138856 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002658
VALIDATED
PLAU MISSION shRNA Bacterial Glycerol Stock
plasminogen activator, urokinase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-205s21c1
Sequence:CCGGGCAGCAATGAACTTCATCAAGCTCGAGCTTGATGAAGTTCATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002658.3-1039s21c1
Sequence:CCGGTCTGCCTGCCCTCGATGTATACTCGAGTATACATCGAGGGCAGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.2-1308s1c1
Sequence:CCGGGCCGTGGATGTGCCCTGAAGGCTCGAGCCTTCAGGGCACATCCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.2-177s1c1
Sequence:CCGGGCAGCAATGAACTTCATCAAGCTCGAGCTTGATGAAGTTCATTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.2-436s1c1
Sequence:CCGGCCACAGATCTGATGCTCTTCACTCGAGTGAAGAGCATCAGATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-1305s21c1
Sequence:CCGGCGCATGACTTTGACTGGAATTCTCGAGAATTCCAGTCAAAGTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-955s21c1
Sequence:CCGGTTGCTCACCACAACGACATTGCTCGAGCAATGTCGTTGTGGTGAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.2-298s1c1
Sequence:CCGGGCACTGTGAAATAGATAAGTCCTCGAGGACTTATCTATTTCACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-1580s21c1
Sequence:CCGGGGGCGAACGACAATAGCTTTACTCGAGTAAAGCTATTGTCGTTCGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-1235s1c1
Sequence:CCGGCGCATGACTTTGACTGGAATTCTCGAGAATTCCAGTCAAAGTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.1-828s1c1
Sequence:CCGGAGATGAAGTTTGAGGTGGAAACTCGAGTTTCCACCTCAAACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-549s1c1
Sequence:CCGGCCTCTCCTCCAGAAGAATTAACTCGAGTTAATTCTTCTGGAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-763s1c1
Sequence:CCGGCCCAAAGAAGGAGGACTACATCTCGAGATGTAGTCCTCCTTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002658
VALIDATED
PLAU MISSION shRNA shRNA Plasmid DNA
plasminogen activator, urokinase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-205s21c1
Sequence:CCGGGCAGCAATGAACTTCATCAAGCTCGAGCTTGATGAAGTTCATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002658.3-1039s21c1
Sequence:CCGGTCTGCCTGCCCTCGATGTATACTCGAGTATACATCGAGGGCAGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.2-1308s1c1
Sequence:CCGGGCCGTGGATGTGCCCTGAAGGCTCGAGCCTTCAGGGCACATCCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.2-177s1c1
Sequence:CCGGGCAGCAATGAACTTCATCAAGCTCGAGCTTGATGAAGTTCATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.2-436s1c1
Sequence:CCGGCCACAGATCTGATGCTCTTCACTCGAGTGAAGAGCATCAGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-1305s21c1
Sequence:CCGGCGCATGACTTTGACTGGAATTCTCGAGAATTCCAGTCAAAGTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-955s21c1
Sequence:CCGGTTGCTCACCACAACGACATTGCTCGAGCAATGTCGTTGTGGTGAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.2-298s1c1
Sequence:CCGGGCACTGTGAAATAGATAAGTCCTCGAGGACTTATCTATTTCACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-1580s21c1
Sequence:CCGGGGGCGAACGACAATAGCTTTACTCGAGTAAAGCTATTGTCGTTCGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-1235s1c1
Sequence:CCGGCGCATGACTTTGACTGGAATTCTCGAGAATTCCAGTCAAAGTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.1-828s1c1
Sequence:CCGGAGATGAAGTTTGAGGTGGAAACTCGAGTTTCCACCTCAAACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-549s1c1
Sequence:CCGGCCTCTCCTCCAGAAGAATTAACTCGAGTTAATTCTTCTGGAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-763s1c1
Sequence:CCGGCCCAAAGAAGGAGGACTACATCTCGAGATGTAGTCCTCCTTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002658
VALIDATED
PLAU MISSION shRNA Lentiviral Transduction Particles
plasminogen activator, urokinase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-205s21c1
Sequence:CCGGGCAGCAATGAACTTCATCAAGCTCGAGCTTGATGAAGTTCATTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002658.3-1039s21c1
Sequence:CCGGTCTGCCTGCCCTCGATGTATACTCGAGTATACATCGAGGGCAGGCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.2-1308s1c1
Sequence:CCGGGCCGTGGATGTGCCCTGAAGGCTCGAGCCTTCAGGGCACATCCACGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.2-177s1c1
Sequence:CCGGGCAGCAATGAACTTCATCAAGCTCGAGCTTGATGAAGTTCATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.2-436s1c1
Sequence:CCGGCCACAGATCTGATGCTCTTCACTCGAGTGAAGAGCATCAGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-1305s21c1
Sequence:CCGGCGCATGACTTTGACTGGAATTCTCGAGAATTCCAGTCAAAGTCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-955s21c1
Sequence:CCGGTTGCTCACCACAACGACATTGCTCGAGCAATGTCGTTGTGGTGAGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.2-298s1c1
Sequence:CCGGGCACTGTGAAATAGATAAGTCCTCGAGGACTTATCTATTTCACAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002658.3-1580s21c1
Sequence:CCGGGGGCGAACGACAATAGCTTTACTCGAGTAAAGCTATTGTCGTTCGCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-1235s1c1
Sequence:CCGGCGCATGACTTTGACTGGAATTCTCGAGAATTCCAGTCAAAGTCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002658.1-828s1c1
Sequence:CCGGAGATGAAGTTTGAGGTGGAAACTCGAGTTTCCACCTCAAACTTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-549s1c1
Sequence:CCGGCCTCTCCTCCAGAAGAATTAACTCGAGTTAATTCTTCTGGAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002658.1-763s1c1
Sequence:CCGGCCCAAAGAAGGAGGACTACATCTCGAGATGTAGTCCTCCTTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008873
PLAU MISSION shRNA Bacterial Glycerol Stock
plasminogen activator, urokinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-1107s1c1
Sequence:CCGGCCCACTACTATGGCTCTGAAACTCGAGTTTCAGAGCCATAGTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-835s1c1
Sequence:CCGGGCAGCTCATCTTGCACGAATACTCGAGTATTCGTGCAAGATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-166s1c1
Sequence:CCGGCGGAGGTGTATGCGTGTCCTACTCGAGTAGGACACGCATACACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-870s1c1
Sequence:CCGGGCCTGGCCTACCATAATGATACTCGAGTATCATTATGGTAGGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-378s1c1
Sequence:CCGGCCCACAGACCTGATGCTATTACTCGAGTAATAGCATCAGGTCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008873
PLAU MISSION shRNA shRNA Plasmid DNA
plasminogen activator, urokinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-1107s1c1
Sequence:CCGGCCCACTACTATGGCTCTGAAACTCGAGTTTCAGAGCCATAGTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-835s1c1
Sequence:CCGGGCAGCTCATCTTGCACGAATACTCGAGTATTCGTGCAAGATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-166s1c1
Sequence:CCGGCGGAGGTGTATGCGTGTCCTACTCGAGTAGGACACGCATACACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-870s1c1
Sequence:CCGGGCCTGGCCTACCATAATGATACTCGAGTATCATTATGGTAGGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-378s1c1
Sequence:CCGGCCCACAGACCTGATGCTATTACTCGAGTAATAGCATCAGGTCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008873
PLAU MISSION shRNA Lentiviral Transduction Particles
plasminogen activator, urokinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-1107s1c1
Sequence:CCGGCCCACTACTATGGCTCTGAAACTCGAGTTTCAGAGCCATAGTAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-835s1c1
Sequence:CCGGGCAGCTCATCTTGCACGAATACTCGAGTATTCGTGCAAGATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-166s1c1
Sequence:CCGGCGGAGGTGTATGCGTGTCCTACTCGAGTAGGACACGCATACACCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-870s1c1
Sequence:CCGGGCCTGGCCTACCATAATGATACTCGAGTATCATTATGGTAGGCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008873.2-378s1c1
Sequence:CCGGCCCACAGACCTGATGCTATTACTCGAGTAATAGCATCAGGTCTGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)