EMAIL THIS PAGE TO A FRIEND

PLAUR

plasminogen activator, urokinase receptor

133 Gene Product Result for
Synonyms: CD87 U-PAR UPAR URKR
Gene ID:
Human(5329) Summary: This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]
Mouse(18793) plasminogen activator, urokinase receptor
Rat(50692) plasminogen activator, urokinase receptor
Horse(100033904) plasminogen activator, urokinase receptor
dog(476446) plasminogen activator, urokinase receptor
domestic cat(101091240) plasminogen activator, urokinase receptor
cow(281983) plasminogen activator, urokinase receptor
sheep(100302564) plasminogen activator, urokinase receptor
domestic guinea pig(100715207) plasminogen activator, urokinase receptor
naked mole-rat(101705929) plasminogen activator, urokinase receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002659 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005376 siRNAs that have been validated in the lab human pricing
NM_001005377 siRNAs that have been validated in the lab human pricing
NM_002659 siRNAs that have been validated in the lab human pricing
NM_017350 Rosetta Predictions rat pricing
NM_134352 Rosetta Predictions rat pricing
NM_011113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005376 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130171 validated 466
2 SASI_Hs01_00130172 predicted 472
3 SASI_Hs01_00130173 predicted 491
4 SASI_Hs01_00130175 predicted 537
5 SASI_Hs01_00130176 predicted 556
6 SASI_Hs01_00130177 predicted 372
7 SASI_Hs01_00130178 predicted 422
8 SASI_Hs01_00130179 predicted 750
9 SASI_Hs01_00130180 predicted 686
10 SASI_Hs02_00304887 predicted 805
11 SASI_Hs01_00130174 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005377 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169743 validated 467
2 SASI_Hs01_00169744 predicted 470
3 SASI_Hs01_00169745 predicted 490
4 SASI_Hs01_00169746 predicted 924
5 SASI_Hs01_00169747 predicted 919
6 SASI_Hs01_00169748 predicted 578
7 SASI_Hs01_00169749 predicted 545
8 SASI_Hs01_00169751 predicted 920
9 SASI_Hs01_00169752 predicted 376
10 SASI_Hs02_00304888 predicted 423
11 SASI_Hs01_00169750 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002659 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079310 validated 465
2 SASI_Hs01_00079311 predicted 472
3 SASI_Hs01_00079312 predicted 494
4 SASI_Hs01_00079313 predicted 1056
5 SASI_Hs01_00079314 predicted 578
6 SASI_Hs01_00079315 predicted 537
7 SASI_Hs01_00079316 predicted 368
8 SASI_Hs01_00079317 predicted 811
9 SASI_Hs01_00079318 predicted 423
10 SASI_Hs01_00079319 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097978 predicted 978
2 SASI_Rn01_00097979 predicted 916
3 SASI_Rn01_00097980 predicted 1010
4 SASI_Rn01_00097981 predicted 982
5 SASI_Rn01_00097982 predicted 924
6 SASI_Rn01_00097983 predicted 911
7 SASI_Rn01_00097984 predicted 1009
8 SASI_Rn01_00097985 predicted 1007
9 SASI_Rn01_00097986 predicted 922
10 SASI_Rn01_00097987 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087536 predicted 982
2 SASI_Rn01_00087537 predicted 927
3 SASI_Rn01_00087538 predicted 1020
4 SASI_Rn01_00087539 predicted 984
5 SASI_Rn01_00087540 predicted 928
6 SASI_Rn01_00087541 predicted 923
7 SASI_Rn01_00087542 predicted 1016
8 SASI_Rn01_00087543 predicted 1018
9 SASI_Rn01_00087544 predicted 922
10 SASI_Rn01_00087545 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155637 predicted 227
2 SASI_Mm01_00155638 predicted 632
3 SASI_Mm01_00155639 predicted 761
4 SASI_Mm01_00155640 predicted 419
5 SASI_Mm01_00155641 predicted 921
6 SASI_Mm01_00155642 predicted 757
7 SASI_Mm01_00155643 predicted 685
8 SASI_Mm01_00155644 predicted 444
9 SASI_Mm01_00155645 predicted 331
10 SASI_Mm01_00155646 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002659
VALIDATED
PLAUR MISSION shRNA Bacterial Glycerol Stock
plasminogen activator, urokinase receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-1144s1c1
Sequence:CCGGCCCATGAATCAATGTCTGGTACTCGAGTACCAGACATTGATTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-1255s1c1
Sequence:CCGGGCCTTCAGCATGAACCACATTCTCGAGAATGTGGTTCATGCTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002659.1-671s1c1
Sequence:CCGGGCTTGAAGATCACCAGCCTTACTCGAGTAAGGCTGGTGATCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002659.1-987s1c1
Sequence:CCGGCCACTTCCTGAAATGCTGCAACTCGAGTTGCAGCATTTCAGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-844s1c1
Sequence:CCGGCCTGAAGAACAGTGCCTGGATCTCGAGATCCAGGCACTGTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-1304s21c1
Sequence:CCGGAGCCCTACAGACTTGCTGTGTCTCGAGACACAGCAAGTCTGTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-1220s21c1
Sequence:CCGGCACTCTCCTCTGGACCTAAACCTCGAGGTTTAGGTCCAGAGGAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002659.2-692s21c1
Sequence:CCGGAGGTGAAGAAGGGCGTCCAAACTCGAGTTTGGACGCCCTTCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002659.2-791s21c1
Sequence:CCGGCCACTTCCTGAAATGCTGCAACTCGAGTTGCAGCATTTCAGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-565s21c1
Sequence:CCGGGCCGTTACCTCGAATGCATTTCTCGAGAAATGCATTCGAGGTAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002659
VALIDATED
PLAUR MISSION shRNA shRNA Plasmid DNA
plasminogen activator, urokinase receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-1144s1c1
Sequence:CCGGCCCATGAATCAATGTCTGGTACTCGAGTACCAGACATTGATTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-1255s1c1
Sequence:CCGGGCCTTCAGCATGAACCACATTCTCGAGAATGTGGTTCATGCTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002659.1-671s1c1
Sequence:CCGGGCTTGAAGATCACCAGCCTTACTCGAGTAAGGCTGGTGATCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002659.1-987s1c1
Sequence:CCGGCCACTTCCTGAAATGCTGCAACTCGAGTTGCAGCATTTCAGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-844s1c1
Sequence:CCGGCCTGAAGAACAGTGCCTGGATCTCGAGATCCAGGCACTGTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-1304s21c1
Sequence:CCGGAGCCCTACAGACTTGCTGTGTCTCGAGACACAGCAAGTCTGTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-1220s21c1
Sequence:CCGGCACTCTCCTCTGGACCTAAACCTCGAGGTTTAGGTCCAGAGGAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002659.2-692s21c1
Sequence:CCGGAGGTGAAGAAGGGCGTCCAAACTCGAGTTTGGACGCCCTTCTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002659.2-791s21c1
Sequence:CCGGCCACTTCCTGAAATGCTGCAACTCGAGTTGCAGCATTTCAGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-565s21c1
Sequence:CCGGGCCGTTACCTCGAATGCATTTCTCGAGAAATGCATTCGAGGTAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002659
VALIDATED
PLAUR MISSION shRNA Lentiviral Transduction Particles
plasminogen activator, urokinase receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-1144s1c1
Sequence:CCGGCCCATGAATCAATGTCTGGTACTCGAGTACCAGACATTGATTCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-1255s1c1
Sequence:CCGGGCCTTCAGCATGAACCACATTCTCGAGAATGTGGTTCATGCTGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002659.1-671s1c1
Sequence:CCGGGCTTGAAGATCACCAGCCTTACTCGAGTAAGGCTGGTGATCTTCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002659.1-987s1c1
Sequence:CCGGCCACTTCCTGAAATGCTGCAACTCGAGTTGCAGCATTTCAGGAAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002659.1-844s1c1
Sequence:CCGGCCTGAAGAACAGTGCCTGGATCTCGAGATCCAGGCACTGTTCTTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-1304s21c1
Sequence:CCGGAGCCCTACAGACTTGCTGTGTCTCGAGACACAGCAAGTCTGTAGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-1220s21c1
Sequence:CCGGCACTCTCCTCTGGACCTAAACCTCGAGGTTTAGGTCCAGAGGAGAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002659.2-692s21c1
Sequence:CCGGAGGTGAAGAAGGGCGTCCAAACTCGAGTTTGGACGCCCTTCTTCACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002659.2-791s21c1
Sequence:CCGGCCACTTCCTGAAATGCTGCAACTCGAGTTGCAGCATTTCAGGAAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002659.2-565s21c1
Sequence:CCGGGCCGTTACCTCGAATGCATTTCTCGAGAAATGCATTCGAGGTAACGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011113
VALIDATED
PLAUR MISSION shRNA Bacterial Glycerol Stock
plasminogen activator, urokinase receptor
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-165s1c1
Sequence:CCGGCTTCGGGAATGGCAAGATGATCTCGAGATCATCTTGCCATTCCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-435s1c1
Sequence:CCGGCCTACAGAGCACTGTATTGAACTCGAGTTCAATACAGTGCTCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011113.2-1152s1c1
Sequence:CCGGGCCTCTTAGTTGAGATAATATCTCGAGATATTATCTCAACTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-769s1c1
Sequence:CCGGGAAACCGGAGTTATACCGTAACTCGAGTTACGGTATAACTCCGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011113.2-565s1c1
Sequence:CCGGCCTTTCACTTCCTGAAGTGTTCTCGAGAACACTTCAGGAAGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-761s21c1
Sequence:CCGGGTGCTGGGAAACCGGAGTTATCTCGAGATAACTCCGGTTTCCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-585s21c1
Sequence:CCGGGCAACTACACCCACTGCAATGCTCGAGCATTGCAGTGGGTGTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-230s21c1
Sequence:CCGGACCAACAGGACCATGAGTTACCTCGAGGTAACTCATGGTCCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-1151s21c1
Sequence:CCGGGCCTCTTAGTTGAGATAATATCTCGAGATATTATCTCAACTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-624s21c1
Sequence:CCGGTTCAGAGCTTTCCACCGAATGCTCGAGCATTCGGTGGAAAGCTCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-484s21c1
Sequence:CCGGCTTGAAGGATGAGGACTACACCTCGAGGTGTAGTCCTCATCCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-166s21c1
Sequence:CCGGTCGGGAATGGCAAGATGATAGCTCGAGCTATCATCTTGCCATTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-86s21c1
Sequence:CCGGTGCATGCAGTGTGAGAGTAACCTCGAGGTTACTCTCACACTGCATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011113
VALIDATED
PLAUR MISSION shRNA shRNA Plasmid DNA
plasminogen activator, urokinase receptor
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-165s1c1
Sequence:CCGGCTTCGGGAATGGCAAGATGATCTCGAGATCATCTTGCCATTCCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-435s1c1
Sequence:CCGGCCTACAGAGCACTGTATTGAACTCGAGTTCAATACAGTGCTCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011113.2-1152s1c1
Sequence:CCGGGCCTCTTAGTTGAGATAATATCTCGAGATATTATCTCAACTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-769s1c1
Sequence:CCGGGAAACCGGAGTTATACCGTAACTCGAGTTACGGTATAACTCCGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011113.2-565s1c1
Sequence:CCGGCCTTTCACTTCCTGAAGTGTTCTCGAGAACACTTCAGGAAGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-761s21c1
Sequence:CCGGGTGCTGGGAAACCGGAGTTATCTCGAGATAACTCCGGTTTCCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-585s21c1
Sequence:CCGGGCAACTACACCCACTGCAATGCTCGAGCATTGCAGTGGGTGTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-230s21c1
Sequence:CCGGACCAACAGGACCATGAGTTACCTCGAGGTAACTCATGGTCCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-1151s21c1
Sequence:CCGGGCCTCTTAGTTGAGATAATATCTCGAGATATTATCTCAACTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-624s21c1
Sequence:CCGGTTCAGAGCTTTCCACCGAATGCTCGAGCATTCGGTGGAAAGCTCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-484s21c1
Sequence:CCGGCTTGAAGGATGAGGACTACACCTCGAGGTGTAGTCCTCATCCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-166s21c1
Sequence:CCGGTCGGGAATGGCAAGATGATAGCTCGAGCTATCATCTTGCCATTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-86s21c1
Sequence:CCGGTGCATGCAGTGTGAGAGTAACCTCGAGGTTACTCTCACACTGCATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011113
VALIDATED
PLAUR MISSION shRNA Lentiviral Transduction Particles
plasminogen activator, urokinase receptor
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-165s1c1
Sequence:CCGGCTTCGGGAATGGCAAGATGATCTCGAGATCATCTTGCCATTCCCGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-435s1c1
Sequence:CCGGCCTACAGAGCACTGTATTGAACTCGAGTTCAATACAGTGCTCTGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011113.2-1152s1c1
Sequence:CCGGGCCTCTTAGTTGAGATAATATCTCGAGATATTATCTCAACTAAGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011113.2-769s1c1
Sequence:CCGGGAAACCGGAGTTATACCGTAACTCGAGTTACGGTATAACTCCGGTTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011113.2-565s1c1
Sequence:CCGGCCTTTCACTTCCTGAAGTGTTCTCGAGAACACTTCAGGAAGTGAAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-761s21c1
Sequence:CCGGGTGCTGGGAAACCGGAGTTATCTCGAGATAACTCCGGTTTCCCAGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-585s21c1
Sequence:CCGGGCAACTACACCCACTGCAATGCTCGAGCATTGCAGTGGGTGTAGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-230s21c1
Sequence:CCGGACCAACAGGACCATGAGTTACCTCGAGGTAACTCATGGTCCTGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-1151s21c1
Sequence:CCGGGCCTCTTAGTTGAGATAATATCTCGAGATATTATCTCAACTAAGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-624s21c1
Sequence:CCGGTTCAGAGCTTTCCACCGAATGCTCGAGCATTCGGTGGAAAGCTCTGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-484s21c1
Sequence:CCGGCTTGAAGGATGAGGACTACACCTCGAGGTGTAGTCCTCATCCTTCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-166s21c1
Sequence:CCGGTCGGGAATGGCAAGATGATAGCTCGAGCTATCATCTTGCCATTCCCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000307463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011113.3-86s21c1
Sequence:CCGGTGCATGCAGTGTGAGAGTAACCTCGAGGTTACTCTCACACTGCATGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???