EMAIL THIS PAGE TO A FRIEND

PLBD1

phospholipase B domain containing 1

54 Gene Product Result for
UniProtKB ID: Q6P4A8, A8K4E9, Q9BVV3, Q9H625
Gene ID:
Mouse(66857) phospholipase B domain containing 1
Rat(297694) phospholipase B domain containing 1
Zebrafish(569736) phospholipase B domain containing 1
Horse(100066968) phospholipase B domain containing 1
domestic cat(101094860) phospholipase B domain containing 1
dog(486673) phospholipase B domain containing 1
chicken(417967) phospholipase B domain containing 1
cow(317710) phospholipase B domain containing 1
sheep(101108736) phospholipase B domain containing 1
naked mole-rat(101721231) phospholipase B domain containing 1
domestic guinea pig(100713563) phospholipase B domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024829 Rosetta Predictions human pricing
NM_001013927 Rosetta Predictions rat pricing
NM_025806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081569 predicted 1484
2 SASI_Hs01_00081570 predicted 1445
3 SASI_Hs01_00081571 predicted 836
4 SASI_Hs02_00357390 predicted 1060
5 SASI_Hs01_00081572 predicted 718
6 SASI_Hs01_00081573 predicted 454
7 SASI_Hs02_00357391 predicted 1051
8 SASI_Hs01_00081575 predicted 1342
9 SASI_Hs01_00081576 predicted 1358
10 SASI_Hs01_00081577 predicted 539
11 SASI_Hs01_00081574 predicted 683
12 SASI_Hs01_00081578 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115316 predicted 1452
2 SASI_Rn01_00115317 predicted 456
3 SASI_Rn01_00115318 predicted 1358
4 SASI_Rn01_00115319 predicted 1266
5 SASI_Rn01_00115320 predicted 1313
6 SASI_Rn02_00201223 predicted 816
7 SASI_Rn01_00115321 predicted 1395
8 SASI_Rn01_00115322 predicted 442
9 SASI_Rn01_00115324 predicted 1507
10 SASI_Rn01_00115325 predicted 1180
11 SASI_Rn01_00115323 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163837 predicted 743
2 SASI_Mm01_00163838 predicted 1319
3 SASI_Mm01_00163839 predicted 1025
4 SASI_Mm01_00163840 predicted 1330
5 SASI_Mm02_00329049 predicted 1024
6 SASI_Mm01_00163841 predicted 513
7 SASI_Mm01_00163842 predicted 1414
8 SASI_Mm02_00329050 predicted 1334
9 SASI_Mm01_00163844 predicted 934
10 SASI_Mm01_00163846 predicted 1245
11 SASI_Mm01_00163843 predicted 1219
12 SASI_Mm01_00163845 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024829
PLBD1 MISSION shRNA Bacterial Glycerol Stock
phospholipase B domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-1036s21c1
Sequence:CCGGTTCTTAGCAGTGGATTGATATCTCGAGATATCAATCCACTGCTAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-836s21c1
Sequence:CCGGGGGACATTGCTCCGCTCTTATCTCGAGATAAGAGCGGAGCAATGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-615s21c1
Sequence:CCGGGAATACAAGACTGATTCATTTCTCGAGAAATGAATCAGTCTTGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-1196s21c1
Sequence:CCGGATACAACTCTGGCACCTATAACTCGAGTTATAGGTGCCAGAGTTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-647s21c1
Sequence:CCGGAGGCTATGTGATGGCACAAATCTCGAGATTTGTGCCATCACATAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-1625s1c1
Sequence:CCGGGCAGAGGTCTACAACTTTGATCTCGAGATCAAAGTTGTAGACCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-141s1c1
Sequence:CCGGGAGTCTACTATGCAACTGCATCTCGAGATGCAGTTGCATAGTAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-301s1c1
Sequence:CCGGCCTGAGCAATGAGATCATCATCTCGAGATGATGATCTCATTGCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-358s1c1
Sequence:CCGGCCCACACATGAATGACCACTACTCGAGTAGTGGTCATTCATGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024829.2-397s1c1
Sequence:CCGGGCTGATCACGAAACCTTCCATCTCGAGATGGAAGGTTTCGTGATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-1207s1c1
Sequence:CCGGGAAAGGATATTGGCCCTCCTACTCGAGTAGGAGGGCCAATATCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024829.2-137s1c1
Sequence:CCGGGCAGGAGTCTACTATGCAACTCTCGAGAGTTGCATAGTAGACTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024829
PLBD1 MISSION shRNA shRNA Plasmid DNA
phospholipase B domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-1036s21c1
Sequence:CCGGTTCTTAGCAGTGGATTGATATCTCGAGATATCAATCCACTGCTAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-836s21c1
Sequence:CCGGGGGACATTGCTCCGCTCTTATCTCGAGATAAGAGCGGAGCAATGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-615s21c1
Sequence:CCGGGAATACAAGACTGATTCATTTCTCGAGAAATGAATCAGTCTTGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-1196s21c1
Sequence:CCGGATACAACTCTGGCACCTATAACTCGAGTTATAGGTGCCAGAGTTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-647s21c1
Sequence:CCGGAGGCTATGTGATGGCACAAATCTCGAGATTTGTGCCATCACATAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-1625s1c1
Sequence:CCGGGCAGAGGTCTACAACTTTGATCTCGAGATCAAAGTTGTAGACCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-141s1c1
Sequence:CCGGGAGTCTACTATGCAACTGCATCTCGAGATGCAGTTGCATAGTAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-301s1c1
Sequence:CCGGCCTGAGCAATGAGATCATCATCTCGAGATGATGATCTCATTGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-358s1c1
Sequence:CCGGCCCACACATGAATGACCACTACTCGAGTAGTGGTCATTCATGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024829.2-397s1c1
Sequence:CCGGGCTGATCACGAAACCTTCCATCTCGAGATGGAAGGTTTCGTGATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-1207s1c1
Sequence:CCGGGAAAGGATATTGGCCCTCCTACTCGAGTAGGAGGGCCAATATCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024829.2-137s1c1
Sequence:CCGGGCAGGAGTCTACTATGCAACTCTCGAGAGTTGCATAGTAGACTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024829
PLBD1 MISSION shRNA Lentiviral Transduction Particles
phospholipase B domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-1036s21c1
Sequence:CCGGTTCTTAGCAGTGGATTGATATCTCGAGATATCAATCCACTGCTAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-836s21c1
Sequence:CCGGGGGACATTGCTCCGCTCTTATCTCGAGATAAGAGCGGAGCAATGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-615s21c1
Sequence:CCGGGAATACAAGACTGATTCATTTCTCGAGAAATGAATCAGTCTTGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-1196s21c1
Sequence:CCGGATACAACTCTGGCACCTATAACTCGAGTTATAGGTGCCAGAGTTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024829.5-647s21c1
Sequence:CCGGAGGCTATGTGATGGCACAAATCTCGAGATTTGTGCCATCACATAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-1625s1c1
Sequence:CCGGGCAGAGGTCTACAACTTTGATCTCGAGATCAAAGTTGTAGACCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-141s1c1
Sequence:CCGGGAGTCTACTATGCAACTGCATCTCGAGATGCAGTTGCATAGTAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-301s1c1
Sequence:CCGGCCTGAGCAATGAGATCATCATCTCGAGATGATGATCTCATTGCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-358s1c1
Sequence:CCGGCCCACACATGAATGACCACTACTCGAGTAGTGGTCATTCATGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024829.2-397s1c1
Sequence:CCGGGCTGATCACGAAACCTTCCATCTCGAGATGGAAGGTTTCGTGATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024829.2-1207s1c1
Sequence:CCGGGAAAGGATATTGGCCCTCCTACTCGAGTAGGAGGGCCAATATCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024829.2-137s1c1
Sequence:CCGGGCAGGAGTCTACTATGCAACTCTCGAGAGTTGCATAGTAGACTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025806
PLBD1 MISSION shRNA Bacterial Glycerol Stock
phospholipase B domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-896s1c1
Sequence:CCGGGCCATGCTCAGGATCTATAAACTCGAGTTTATAGATCCTGAGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-504s21c1
Sequence:CCGGACCCACAGCTGTTCAAGAATCCTCGAGGATTCTTGAACAGCTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-474s21c1
Sequence:CCGGTACACATGTACGACCACTTCACTCGAGTGAAGTGGTCGTACATGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-515s21c1
Sequence:CCGGTTCAAGAATCCTTCCATTGTGCTCGAGCACAATGGAAGGATTCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-485s21c1
Sequence:CCGGGACCACTTCACGAACCTGTACCTCGAGGTACAGGTTCGTGAAGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-460s21c1
Sequence:CCGGCTACCTCACTGCTCTACACATCTCGAGATGTGTAGAGCAGTGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-1485s1c1
Sequence:CCGGCCATGAAATATATCATGCGATCTCGAGATCGCATGATATATTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-415s1c1
Sequence:CCGGCCTGTCCAATGAGATCATCATCTCGAGATGATGATCTCATTGGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-816s1c1
Sequence:CCGGGCCACTGTTCTGCTCTTATTACTCGAGTAATAAGAGCAGAACAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025806
PLBD1 MISSION shRNA shRNA Plasmid DNA
phospholipase B domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-896s1c1
Sequence:CCGGGCCATGCTCAGGATCTATAAACTCGAGTTTATAGATCCTGAGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-504s21c1
Sequence:CCGGACCCACAGCTGTTCAAGAATCCTCGAGGATTCTTGAACAGCTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-474s21c1
Sequence:CCGGTACACATGTACGACCACTTCACTCGAGTGAAGTGGTCGTACATGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-515s21c1
Sequence:CCGGTTCAAGAATCCTTCCATTGTGCTCGAGCACAATGGAAGGATTCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-485s21c1
Sequence:CCGGGACCACTTCACGAACCTGTACCTCGAGGTACAGGTTCGTGAAGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-460s21c1
Sequence:CCGGCTACCTCACTGCTCTACACATCTCGAGATGTGTAGAGCAGTGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-1485s1c1
Sequence:CCGGCCATGAAATATATCATGCGATCTCGAGATCGCATGATATATTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-415s1c1
Sequence:CCGGCCTGTCCAATGAGATCATCATCTCGAGATGATGATCTCATTGGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-816s1c1
Sequence:CCGGGCCACTGTTCTGCTCTTATTACTCGAGTAATAAGAGCAGAACAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025806
PLBD1 MISSION shRNA Lentiviral Transduction Particles
phospholipase B domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-896s1c1
Sequence:CCGGGCCATGCTCAGGATCTATAAACTCGAGTTTATAGATCCTGAGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-504s21c1
Sequence:CCGGACCCACAGCTGTTCAAGAATCCTCGAGGATTCTTGAACAGCTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-474s21c1
Sequence:CCGGTACACATGTACGACCACTTCACTCGAGTGAAGTGGTCGTACATGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-515s21c1
Sequence:CCGGTTCAAGAATCCTTCCATTGTGCTCGAGCACAATGGAAGGATTCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-485s21c1
Sequence:CCGGGACCACTTCACGAACCTGTACCTCGAGGTACAGGTTCGTGAAGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025806.1-460s21c1
Sequence:CCGGCTACCTCACTGCTCTACACATCTCGAGATGTGTAGAGCAGTGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-1485s1c1
Sequence:CCGGCCATGAAATATATCATGCGATCTCGAGATCGCATGATATATTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-415s1c1
Sequence:CCGGCCTGTCCAATGAGATCATCATCTCGAGATGATGATCTCATTGGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025806.1-816s1c1
Sequence:CCGGGCCACTGTTCTGCTCTTATTACTCGAGTAATAAGAGCAGAACAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)