EMAIL THIS PAGE TO A FRIEND

PLBD2

phospholipase B domain containing 2

55 Gene Product Result for
Synonyms: P76
UniProtKB ID: Q8NHP8
Gene ID:
Mouse(71772) phospholipase B domain containing 2
Rat(246120) phospholipase B domain containing 2
domestic guinea pig(100718155) phospholipase B domain containing 2
naked mole-rat(101721570) phospholipase B domain containing 2
cow(514347) phospholipase B domain containing 2
sheep(101108861) phospholipase B domain containing 2
chicken(417031) phospholipase B domain containing 2
Horse(100056432) phospholipase B domain containing 2
domestic cat(101089649) phospholipase B domain containing 2
dog(477493) phospholipase B domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173542 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173542 Rosetta Predictions human pricing
NM_139255 Rosetta Predictions rat pricing
NM_023625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368339 predicted 752
2 SASI_Hs01_00245991 predicted 785
3 SASI_Hs01_00245992 predicted 1771
4 SASI_Hs01_00245993 predicted 1129
5 SASI_Hs01_00245994 predicted 1401
6 SASI_Hs02_00368340 predicted 1420
7 SASI_Hs01_00245996 predicted 1309
8 SASI_Hs01_00245997 predicted 505
9 SASI_Hs01_00245998 predicted 336
10 SASI_Hs01_00245999 predicted 1763
11 SASI_Hs01_00245990 predicted 1455
12 SASI_Hs01_00245995 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268537 predicted 1099
2 SASI_Rn02_00268538 predicted 868
3 SASI_Rn02_00268539 predicted 1338
4 SASI_Rn02_00268540 predicted 1099
5 SASI_Rn02_00268541 predicted 290
6 SASI_Rn02_00268542 predicted 682
7 SASI_Rn01_00094855 predicted 1861
8 SASI_Rn01_00094850 predicted 1437
9 SASI_Rn02_00268543 predicted 1111
10 SASI_Rn02_00268544 predicted 1334
11 SASI_Rn01_00094847 predicted 465
12 SASI_Rn01_00094848 predicted 703
13 SASI_Rn01_00094849 predicted 285
14 SASI_Rn01_00094851 predicted 366
15 SASI_Rn01_00094852 predicted 624
16 SASI_Rn01_00094853 predicted 742
17 SASI_Rn01_00094854 predicted 389
18 SASI_Rn01_00094856 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327232 predicted 335
2 SASI_Mm01_00116638 predicted 1314
3 SASI_Mm02_00327233 predicted 441
4 SASI_Mm01_00116639 predicted 1149
5 SASI_Mm01_00116640 predicted 1324
6 SASI_Mm01_00116641 predicted 1398
7 SASI_Mm02_00327234 predicted 1472
8 SASI_Mm01_00116642 predicted 1175
9 SASI_Mm01_00116643 predicted 847
10 SASI_Mm01_00116644 predicted 1534
11 SASI_Mm01_00116637 predicted 1649
12 SASI_Mm01_00116645 predicted 352
13 SASI_Mm01_00116646 predicted 1513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173542
VALIDATED
PLBD2 MISSION shRNA Bacterial Glycerol Stock
phospholipase B domain containing 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173542.3-2019s21c1
Sequence:CCGGTCTTCTGCCCTGCCCTAAATCCTCGAGGATTTAGGGCAGGGCAGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173542.3-469s21c1
Sequence:CCGGTCGAGTATGAAGTCGGCTACTCTCGAGAGTAGCCGACTTCATACTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173542.2-1459s1c1
Sequence:CCGGGCTGATGAGGTACAATGACTTCTCGAGAAGTCATTGTACCTCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173542.2-526s1c1
Sequence:CCGGGCAGGAAGAGATGGAGTCAAACTCGAGTTTGACTCCATCTCTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173542.2-838s1c1
Sequence:CCGGGCTGCGTGTCATCAAGAAGTACTCGAGTACTTCTTGATGACACGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173542.2-2335s1c1
Sequence:CCGGCCTTGAGGACAGAAACTTGAACTCGAGTTCAAGTTTCTGTCCTCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173542
VALIDATED
PLBD2 MISSION shRNA shRNA Plasmid DNA
phospholipase B domain containing 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173542.3-2019s21c1
Sequence:CCGGTCTTCTGCCCTGCCCTAAATCCTCGAGGATTTAGGGCAGGGCAGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173542.3-469s21c1
Sequence:CCGGTCGAGTATGAAGTCGGCTACTCTCGAGAGTAGCCGACTTCATACTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173542.2-1459s1c1
Sequence:CCGGGCTGATGAGGTACAATGACTTCTCGAGAAGTCATTGTACCTCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173542.2-526s1c1
Sequence:CCGGGCAGGAAGAGATGGAGTCAAACTCGAGTTTGACTCCATCTCTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173542.2-838s1c1
Sequence:CCGGGCTGCGTGTCATCAAGAAGTACTCGAGTACTTCTTGATGACACGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173542.2-2335s1c1
Sequence:CCGGCCTTGAGGACAGAAACTTGAACTCGAGTTCAAGTTTCTGTCCTCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173542
VALIDATED
PLBD2 MISSION shRNA Lentiviral Transduction Particles
phospholipase B domain containing 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173542.3-2019s21c1
Sequence:CCGGTCTTCTGCCCTGCCCTAAATCCTCGAGGATTTAGGGCAGGGCAGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173542.3-469s21c1
Sequence:CCGGTCGAGTATGAAGTCGGCTACTCTCGAGAGTAGCCGACTTCATACTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173542.2-1459s1c1
Sequence:CCGGGCTGATGAGGTACAATGACTTCTCGAGAAGTCATTGTACCTCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173542.2-526s1c1
Sequence:CCGGGCAGGAAGAGATGGAGTCAAACTCGAGTTTGACTCCATCTCTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173542.2-838s1c1
Sequence:CCGGGCTGCGTGTCATCAAGAAGTACTCGAGTACTTCTTGATGACACGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173542.2-2335s1c1
Sequence:CCGGCCTTGAGGACAGAAACTTGAACTCGAGTTCAAGTTTCTGTCCTCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023625
VALIDATED
PLBD2 MISSION shRNA Bacterial Glycerol Stock
phospholipase B domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-1536s21c3
Sequence:CCGGCCAAAGCCTAATGCGGAGAATCTCGAGATTCTCCGCATTAGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-545s21c2
Sequence:CCGGGCAGAGGGAAATGGAGCTTAACTCGAGTTAAGCTCCATTTCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-1532s1c1
Sequence:CCGGCCAAAGCCTAATGCGGAGAATCTCGAGATTCTCCGCATTAGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023625.2-2916s1c1
Sequence:CCGGGCTGACCACTAAGACCCTAAACTCGAGTTTAGGGTCTTAGTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-541s1c1
Sequence:CCGGGCAGAGGGAAATGGAGCTTAACTCGAGTTAAGCTCCATTTCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-1171s1c1
Sequence:CCGGCCAGTGGATGATTGTGGACTACTCGAGTAGTCCACAATCATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023625.2-730s1c1
Sequence:CCGGCCTGAATAAGACCAACACCAACTCGAGTTGGTGTTGGTCTTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-1175s21c1
Sequence:CCGGCCAGTGGATGATTGTGGACTACTCGAGTAGTCCACAATCATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023625.4-2919s21c2
Sequence:CCGGGCTGACCACTAAGACCCTAAACTCGAGTTTAGGGTCTTAGTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-734s21c3
Sequence:CCGGCCTGAATAAGACCAACACCAACTCGAGTTGGTGTTGGTCTTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023625
VALIDATED
PLBD2 MISSION shRNA shRNA Plasmid DNA
phospholipase B domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-1536s21c3
Sequence:CCGGCCAAAGCCTAATGCGGAGAATCTCGAGATTCTCCGCATTAGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-545s21c2
Sequence:CCGGGCAGAGGGAAATGGAGCTTAACTCGAGTTAAGCTCCATTTCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-1532s1c1
Sequence:CCGGCCAAAGCCTAATGCGGAGAATCTCGAGATTCTCCGCATTAGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023625.2-2916s1c1
Sequence:CCGGGCTGACCACTAAGACCCTAAACTCGAGTTTAGGGTCTTAGTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-541s1c1
Sequence:CCGGGCAGAGGGAAATGGAGCTTAACTCGAGTTAAGCTCCATTTCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-1171s1c1
Sequence:CCGGCCAGTGGATGATTGTGGACTACTCGAGTAGTCCACAATCATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023625.2-730s1c1
Sequence:CCGGCCTGAATAAGACCAACACCAACTCGAGTTGGTGTTGGTCTTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-1175s21c1
Sequence:CCGGCCAGTGGATGATTGTGGACTACTCGAGTAGTCCACAATCATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023625.4-2919s21c2
Sequence:CCGGGCTGACCACTAAGACCCTAAACTCGAGTTTAGGGTCTTAGTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-734s21c3
Sequence:CCGGCCTGAATAAGACCAACACCAACTCGAGTTGGTGTTGGTCTTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023625
VALIDATED
PLBD2 MISSION shRNA Lentiviral Transduction Particles
phospholipase B domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-1536s21c3
Sequence:CCGGCCAAAGCCTAATGCGGAGAATCTCGAGATTCTCCGCATTAGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-545s21c2
Sequence:CCGGGCAGAGGGAAATGGAGCTTAACTCGAGTTAAGCTCCATTTCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-1532s1c1
Sequence:CCGGCCAAAGCCTAATGCGGAGAATCTCGAGATTCTCCGCATTAGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023625.2-2916s1c1
Sequence:CCGGGCTGACCACTAAGACCCTAAACTCGAGTTTAGGGTCTTAGTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-541s1c1
Sequence:CCGGGCAGAGGGAAATGGAGCTTAACTCGAGTTAAGCTCCATTTCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023625.2-1171s1c1
Sequence:CCGGCCAGTGGATGATTGTGGACTACTCGAGTAGTCCACAATCATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023625.2-730s1c1
Sequence:CCGGCCTGAATAAGACCAACACCAACTCGAGTTGGTGTTGGTCTTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-1175s21c1
Sequence:CCGGCCAGTGGATGATTGTGGACTACTCGAGTAGTCCACAATCATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023625.4-2919s21c2
Sequence:CCGGGCTGACCACTAAGACCCTAAACTCGAGTTTAGGGTCTTAGTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023625.4-734s21c3
Sequence:CCGGCCTGAATAAGACCAACACCAACTCGAGTTGGTGTTGGTCTTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)