EMAIL THIS PAGE TO A FRIEND

PLCB1

phospholipase C, beta 1 (phosphoinositide-specific)

280 Gene Product Result for
Synonyms: EIEE12 PI-PLC PLC-154 PLC-I PLC154 PLCB1A PLCB1B
Gene ID:
Human(23236) Summary: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18795) phospholipase C, beta 1
Rat(24654) phospholipase C, beta 1 (phosphoinositide-specific)
chicken(427687) phospholipase C, beta 1 (phosphoinositide-specific)
dog(485773) phospholipase C, beta 1 (phosphoinositide-specific)
domestic cat(101092262) phospholipase C, beta 1 (phosphoinositide-specific)
cow(287026) phospholipase C, beta 1 (phosphoinositide-specific)
sheep(101103585) phospholipase C, beta 1 (phosphoinositide-specific)
naked mole-rat(101725860) phospholipase C, beta 1 (phosphoinositide-specific)
domestic guinea pig(100730572) phospholipase C, beta 1 (phosphoinositide-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015192 Rosetta Predictions human pricing
NM_182734 Rosetta Predictions human pricing
NM_001077641 Rosetta Predictions rat pricing
NM_019677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109285 predicted 2153
2 SASI_Hs01_00109286 predicted 1030
3 SASI_Hs01_00109287 predicted 2683
4 SASI_Hs01_00109288 predicted 2228
5 SASI_Hs01_00109289 predicted 2787
6 SASI_Hs01_00109290 predicted 3749
7 SASI_Hs01_00109291 predicted 340
8 SASI_Hs01_00109292 predicted 2720
9 SASI_Hs01_00109293 predicted 2253
10 SASI_Hs01_00109294 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064980 predicted 2156
2 SASI_Hs01_00064981 predicted 1032
3 SASI_Hs01_00064982 predicted 2686
4 SASI_Hs01_00064983 predicted 2225
5 SASI_Hs01_00064984 predicted 2789
6 SASI_Hs01_00064986 predicted 346
7 SASI_Hs01_00064987 predicted 2727
8 SASI_Hs01_00064988 predicted 2257
9 SASI_Hs01_00064989 predicted 2312
10 SASI_Hs02_00370889 predicted 1277
11 SASI_Hs01_00064985 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207642 predicted 825
2 SASI_Rn02_00207643 predicted 2887
3 SASI_Rn02_00207644 predicted 2617
4 SASI_Rn02_00207645 predicted 2224
5 SASI_Rn02_00207646 predicted 3153
6 SASI_Rn02_00207647 predicted 2432
7 SASI_Rn02_00207648 predicted 546
8 SASI_Rn02_00207649 predicted 2390
9 SASI_Rn02_00207650 predicted 1509
10 SASI_Rn02_00207651 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180965 predicted 2385
2 SASI_Mm01_00180966 predicted 2163
3 SASI_Mm01_00180967 predicted 2293
4 SASI_Mm01_00180968 predicted 2464
5 SASI_Mm01_00180969 predicted 2282
6 SASI_Mm01_00180970 predicted 665
7 SASI_Mm01_00180971 predicted 2858
8 SASI_Mm01_00180972 predicted 2231
9 SASI_Mm01_00180973 predicted 1195
10 SASI_Mm01_00180974 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019677
VALIDATED
PLCB1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, beta 1 (phosphoinositide-specific)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-1990s21c1
Sequence:CCGGTCTAACCTGGTGAACTATATTCTCGAGAATATAGTTCACCAGGTTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-2785s21c1
Sequence:CCGGGTAATCGAAGCTCTATCAAACCTCGAGGTTTGATAGAGCTTCGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-3056s21c1
Sequence:CCGGATCTGATCCAGAGCGTGTTAACTCGAGTTAACACGCTCTGGATCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-3512s21c1
Sequence:CCGGAGTGTCAGAACAATCAGTTAACTCGAGTTAACTGATTGTTCTGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-3714s1c1
Sequence:CCGGCCTCCAGTGAGGAGATAGAAACTCGAGTTTCTATCTCCTCACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-304s1c1
Sequence:CCGGCGCATGATAACTGTGGTGTATCTCGAGATACACCACAGTTATCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-2365s1c1
Sequence:CCGGGCTGTCTTTGTCTACATAGAACTCGAGTTCTATGTAGACAAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019677.1-770s1c1
Sequence:CCGGCCCGGCTCAATGAAATCCTTTCTCGAGAAAGGATTTCATTGAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-1902s1c1
Sequence:CCGGGCAGATAAACATGGGCATGTACTCGAGTACATGCCCATGTTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019677
VALIDATED
PLCB1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, beta 1 (phosphoinositide-specific)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-1990s21c1
Sequence:CCGGTCTAACCTGGTGAACTATATTCTCGAGAATATAGTTCACCAGGTTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-2785s21c1
Sequence:CCGGGTAATCGAAGCTCTATCAAACCTCGAGGTTTGATAGAGCTTCGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-3056s21c1
Sequence:CCGGATCTGATCCAGAGCGTGTTAACTCGAGTTAACACGCTCTGGATCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-3512s21c1
Sequence:CCGGAGTGTCAGAACAATCAGTTAACTCGAGTTAACTGATTGTTCTGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-3714s1c1
Sequence:CCGGCCTCCAGTGAGGAGATAGAAACTCGAGTTTCTATCTCCTCACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-304s1c1
Sequence:CCGGCGCATGATAACTGTGGTGTATCTCGAGATACACCACAGTTATCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-2365s1c1
Sequence:CCGGGCTGTCTTTGTCTACATAGAACTCGAGTTCTATGTAGACAAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019677.1-770s1c1
Sequence:CCGGCCCGGCTCAATGAAATCCTTTCTCGAGAAAGGATTTCATTGAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-1902s1c1
Sequence:CCGGGCAGATAAACATGGGCATGTACTCGAGTACATGCCCATGTTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019677
VALIDATED
PLCB1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, beta 1 (phosphoinositide-specific)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-1990s21c1
Sequence:CCGGTCTAACCTGGTGAACTATATTCTCGAGAATATAGTTCACCAGGTTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-2785s21c1
Sequence:CCGGGTAATCGAAGCTCTATCAAACCTCGAGGTTTGATAGAGCTTCGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-3056s21c1
Sequence:CCGGATCTGATCCAGAGCGTGTTAACTCGAGTTAACACGCTCTGGATCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019677.2-3512s21c1
Sequence:CCGGAGTGTCAGAACAATCAGTTAACTCGAGTTAACTGATTGTTCTGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-3714s1c1
Sequence:CCGGCCTCCAGTGAGGAGATAGAAACTCGAGTTTCTATCTCCTCACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-304s1c1
Sequence:CCGGCGCATGATAACTGTGGTGTATCTCGAGATACACCACAGTTATCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-2365s1c1
Sequence:CCGGGCTGTCTTTGTCTACATAGAACTCGAGTTCTATGTAGACAAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019677.1-770s1c1
Sequence:CCGGCCCGGCTCAATGAAATCCTTTCTCGAGAAAGGATTTCATTGAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019677.1-1902s1c1
Sequence:CCGGGCAGATAAACATGGGCATGTACTCGAGTACATGCCCATGTTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182734
VALIDATED
PLCB1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, beta 1 (phosphoinositide-specific)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182734.1-3146s21c1
Sequence:GTACCGGAGTGTCAGAACAATCAGTTAACTCGAGTTAACTGATTGTTCTGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182734.1-4557s21c1
Sequence:GTACCGGATTGGCCTGAAATGATCAAATCTCGAGATTTGATCATTTCAGGCCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-2303s21c1
Sequence:CCGGTTCGGCCAGGCTATCACTATACTCGAGTATAGTGATAGCCTGGCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-1624s21c1
Sequence:CCGGTCTAATCTGGTGAACTATATTCTCGAGAATATAGTTCACCAGATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-760s21c1
Sequence:CCGGCAGCGAGATCCTCGGCTTAATCTCGAGATTAAGCCGAGGATCTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182734.1-5001s1c1
Sequence:CCGGCCGAAGTAGATTTAGAACTTACTCGAGTAAGTTCTAAATCTACTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-1648s1c1
Sequence:CCGGCCAGTCAAGTTTGAGTCATTTCTCGAGAAATGACTCAAACTTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-1750s1c1
Sequence:CCGGCCAGTGGAATTTGTAGAATATCTCGAGATATTCTACAAATTCCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-3171s1c1
Sequence:CCGGGCTCAAAGAAATCTGTGAGAACTCGAGTTCTCACAGATTTCTTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182734.1-347s1c1
Sequence:CCGGCCCATTTGAATCTCGTGGCTTCTCGAGAAGCCACGAGATTCAAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182734
VALIDATED
PLCB1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, beta 1 (phosphoinositide-specific)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182734.1-3146s21c1
Sequence:GTACCGGAGTGTCAGAACAATCAGTTAACTCGAGTTAACTGATTGTTCTGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182734.1-4557s21c1
Sequence:GTACCGGATTGGCCTGAAATGATCAAATCTCGAGATTTGATCATTTCAGGCCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-2303s21c1
Sequence:CCGGTTCGGCCAGGCTATCACTATACTCGAGTATAGTGATAGCCTGGCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-1624s21c1
Sequence:CCGGTCTAATCTGGTGAACTATATTCTCGAGAATATAGTTCACCAGATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-760s21c1
Sequence:CCGGCAGCGAGATCCTCGGCTTAATCTCGAGATTAAGCCGAGGATCTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182734.1-5001s1c1
Sequence:CCGGCCGAAGTAGATTTAGAACTTACTCGAGTAAGTTCTAAATCTACTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-1648s1c1
Sequence:CCGGCCAGTCAAGTTTGAGTCATTTCTCGAGAAATGACTCAAACTTGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-1750s1c1
Sequence:CCGGCCAGTGGAATTTGTAGAATATCTCGAGATATTCTACAAATTCCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-3171s1c1
Sequence:CCGGGCTCAAAGAAATCTGTGAGAACTCGAGTTCTCACAGATTTCTTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182734.1-347s1c1
Sequence:CCGGCCCATTTGAATCTCGTGGCTTCTCGAGAAGCCACGAGATTCAAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182734
VALIDATED
PLCB1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, beta 1 (phosphoinositide-specific)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182734.1-3146s21c1
Sequence:GTACCGGAGTGTCAGAACAATCAGTTAACTCGAGTTAACTGATTGTTCTGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182734.1-4557s21c1
Sequence:GTACCGGATTGGCCTGAAATGATCAAATCTCGAGATTTGATCATTTCAGGCCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-2303s21c1
Sequence:CCGGTTCGGCCAGGCTATCACTATACTCGAGTATAGTGATAGCCTGGCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-1624s21c1
Sequence:CCGGTCTAATCTGGTGAACTATATTCTCGAGAATATAGTTCACCAGATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182734.1-760s21c1
Sequence:CCGGCAGCGAGATCCTCGGCTTAATCTCGAGATTAAGCCGAGGATCTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182734.1-5001s1c1
Sequence:CCGGCCGAAGTAGATTTAGAACTTACTCGAGTAAGTTCTAAATCTACTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-1648s1c1
Sequence:CCGGCCAGTCAAGTTTGAGTCATTTCTCGAGAAATGACTCAAACTTGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-1750s1c1
Sequence:CCGGCCAGTGGAATTTGTAGAATATCTCGAGATATTCTACAAATTCCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182734.1-3171s1c1
Sequence:CCGGGCTCAAAGAAATCTGTGAGAACTCGAGTTCTCACAGATTTCTTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182734.1-347s1c1
Sequence:CCGGCCCATTTGAATCTCGTGGCTTCTCGAGAAGCCACGAGATTCAAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)