EMAIL THIS PAGE TO A FRIEND

PLCB2

phospholipase C, beta 2

57 Gene Product Result for
UniProtKB ID: Q00722, A8K6J2
Gene ID:
Mouse(18796) phospholipase C, beta 2
Rat(85240) phospholipase C, beta 2
chicken(423014) phospholipase C, beta 2
domestic cat(101090942) phospholipase C, beta 2
Horse(100057315) phospholipase C, beta 2
dog(487491) phospholipase C, beta 2
domestic guinea pig(100714143) phospholipase C, beta 2
naked mole-rat(101708380) phospholipase C, beta 2
Domestic Rabbit(100348672) phospholipase C, beta 2
cow(508888) phospholipase C, beta 2
sheep(101113074) phospholipase C, beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004573 Rosetta Predictions human pricing
NM_053478 Rosetta Predictions rat pricing
NM_177568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180931 predicted 1399
2 SASI_Hs01_00180932 predicted 1247
3 SASI_Hs01_00180933 predicted 1504
4 SASI_Hs01_00180934 predicted 1433
5 SASI_Hs01_00180935 predicted 1554
6 SASI_Hs01_00180936 predicted 557
7 SASI_Hs01_00180937 predicted 2569
8 SASI_Hs01_00180938 predicted 2712
9 SASI_Hs01_00180939 predicted 1233
10 SASI_Hs01_00180940 predicted 3511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058028 predicted 3182
2 SASI_Rn01_00058029 predicted 250
3 SASI_Rn01_00058030 predicted 2355
4 SASI_Rn02_00266072 predicted 2571
5 SASI_Rn01_00058031 predicted 1138
6 SASI_Rn01_00058032 predicted 198
7 SASI_Rn01_00058033 predicted 1872
8 SASI_Rn01_00058034 predicted 3301
9 SASI_Rn01_00058035 predicted 2287
10 SASI_Rn01_00058036 predicted 436
11 SASI_Rn01_00058037 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181055 predicted 458
2 SASI_Mm01_00181056 predicted 529
3 SASI_Mm01_00181057 predicted 868
4 SASI_Mm01_00181058 predicted 214
5 SASI_Mm01_00181059 predicted 3614
6 SASI_Mm01_00181060 predicted 1220
7 SASI_Mm01_00181061 predicted 1888
8 SASI_Mm01_00181062 predicted 2296
9 SASI_Mm02_00347721 predicted 247
10 SASI_Mm01_00181063 predicted 2811
11 SASI_Mm01_00181064 predicted 2306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177568
PLCB2 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, beta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177568.2-3764s1c1
Sequence:CCGGGCAGGGATTAGAGACTATCAACTCGAGTTGATAGTCTCTAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-248s1c1
Sequence:CCGGGCTATTACTTATACTGGACATCTCGAGATGTCCAGTATAAGTAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-2595s1c1
Sequence:CCGGCCAGGATAAGAAGTCCGTGAACTCGAGTTCACGGACTTCTTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-1321s1c1
Sequence:CCGGCCTGTCATCCTATCATTTGAACTCGAGTTCAAATGATAGGATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-771s1c1
Sequence:CCGGGCCAGAAATCGACGAGATCTTCTCGAGAAGATCTCGTCGATTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177568
PLCB2 MISSION shRNA shRNA Plasmid DNA
phospholipase C, beta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177568.2-3764s1c1
Sequence:CCGGGCAGGGATTAGAGACTATCAACTCGAGTTGATAGTCTCTAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-248s1c1
Sequence:CCGGGCTATTACTTATACTGGACATCTCGAGATGTCCAGTATAAGTAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-2595s1c1
Sequence:CCGGCCAGGATAAGAAGTCCGTGAACTCGAGTTCACGGACTTCTTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-1321s1c1
Sequence:CCGGCCTGTCATCCTATCATTTGAACTCGAGTTCAAATGATAGGATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-771s1c1
Sequence:CCGGGCCAGAAATCGACGAGATCTTCTCGAGAAGATCTCGTCGATTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177568
PLCB2 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, beta 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177568.2-3764s1c1
Sequence:CCGGGCAGGGATTAGAGACTATCAACTCGAGTTGATAGTCTCTAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-248s1c1
Sequence:CCGGGCTATTACTTATACTGGACATCTCGAGATGTCCAGTATAAGTAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-2595s1c1
Sequence:CCGGCCAGGATAAGAAGTCCGTGAACTCGAGTTCACGGACTTCTTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-1321s1c1
Sequence:CCGGCCTGTCATCCTATCATTTGAACTCGAGTTCAAATGATAGGATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177568.2-771s1c1
Sequence:CCGGGCCAGAAATCGACGAGATCTTCTCGAGAAGATCTCGTCGATTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004573
VALIDATED
PLCB2 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, beta 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-2070s1c1
Sequence:CCGGCAGCAGAACATGGCAGTATTTCTCGAGAAATACTGCCATGTTCTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004573.x-1538s1c1
Sequence:CCGGCCTCATCAAGAACAAGAAGAACTCGAGTTCTTCTTGTTCTTGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-3266s1c1
Sequence:CCGGCGACACCAAAGAGATGAAGAACTCGAGTTCTTCATCTCTTTGGTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-3669s1c1
Sequence:CCGGCCACTCATAGCAAAGGCAGATCTCGAGATCTGCCTTTGCTATGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-425s21c1
Sequence:CCGGCCTAAGGGCTACTACTTATACCTCGAGGTATAAGTAGTAGCCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-687s21c1
Sequence:CCGGACGTACTGGCCCTAGTCAAACCTCGAGGTTTGACTAGGGCCAGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-1935s21c1
Sequence:CCGGAGATGTCCAGCCTAGTCAATTCTCGAGAATTGACTAGGCTGGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004573.2-4628s21c1
Sequence:CCGGTCTCTTTCCTACTCCTATTAACTCGAGTTAATAGGAGTAGGAAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-1243s21c1
Sequence:CCGGGACGCAGCCACTCAATCATTACTCGAGTAATGATTGAGTGGCTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004573
VALIDATED
PLCB2 MISSION shRNA shRNA Plasmid DNA
phospholipase C, beta 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-2070s1c1
Sequence:CCGGCAGCAGAACATGGCAGTATTTCTCGAGAAATACTGCCATGTTCTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004573.x-1538s1c1
Sequence:CCGGCCTCATCAAGAACAAGAAGAACTCGAGTTCTTCTTGTTCTTGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-3266s1c1
Sequence:CCGGCGACACCAAAGAGATGAAGAACTCGAGTTCTTCATCTCTTTGGTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-3669s1c1
Sequence:CCGGCCACTCATAGCAAAGGCAGATCTCGAGATCTGCCTTTGCTATGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-425s21c1
Sequence:CCGGCCTAAGGGCTACTACTTATACCTCGAGGTATAAGTAGTAGCCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-687s21c1
Sequence:CCGGACGTACTGGCCCTAGTCAAACCTCGAGGTTTGACTAGGGCCAGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-1935s21c1
Sequence:CCGGAGATGTCCAGCCTAGTCAATTCTCGAGAATTGACTAGGCTGGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004573.2-4628s21c1
Sequence:CCGGTCTCTTTCCTACTCCTATTAACTCGAGTTAATAGGAGTAGGAAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-1243s21c1
Sequence:CCGGGACGCAGCCACTCAATCATTACTCGAGTAATGATTGAGTGGCTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004573
VALIDATED
PLCB2 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, beta 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-2070s1c1
Sequence:CCGGCAGCAGAACATGGCAGTATTTCTCGAGAAATACTGCCATGTTCTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004573.x-1538s1c1
Sequence:CCGGCCTCATCAAGAACAAGAAGAACTCGAGTTCTTCTTGTTCTTGATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-3266s1c1
Sequence:CCGGCGACACCAAAGAGATGAAGAACTCGAGTTCTTCATCTCTTTGGTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004573.x-3669s1c1
Sequence:CCGGCCACTCATAGCAAAGGCAGATCTCGAGATCTGCCTTTGCTATGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-425s21c1
Sequence:CCGGCCTAAGGGCTACTACTTATACCTCGAGGTATAAGTAGTAGCCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-687s21c1
Sequence:CCGGACGTACTGGCCCTAGTCAAACCTCGAGGTTTGACTAGGGCCAGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-1935s21c1
Sequence:CCGGAGATGTCCAGCCTAGTCAATTCTCGAGAATTGACTAGGCTGGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004573.2-4628s21c1
Sequence:CCGGTCTCTTTCCTACTCCTATTAACTCGAGTTAATAGGAGTAGGAAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004573.2-1243s21c1
Sequence:CCGGGACGCAGCCACTCAATCATTACTCGAGTAATGATTGAGTGGCTGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)