EMAIL THIS PAGE TO A FRIEND

PLCB3

phospholipase C, beta 3 (phosphatidylinositol-specific)

53 Gene Product Result for
UniProtKB ID: Q01970, A5PKZ6, G5E960, Q8N1A4
Gene ID:
Human(5331) Summary: This gene encodes a member of the phosphoinositide phospholipase C beta enzyme family that catalyze the production of the secondary messengers diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol in G-protein-linked receptor-mediated signal transduction. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(18797) phospholipase C, beta 3
Rat(29322) phospholipase C, beta 3 (phosphatidylinositol-specific)
Zebrafish(100001532) phospholipase C, beta 3 (phosphatidylinositol-specific)
dog(476034) phospholipase C, beta 3 (phosphatidylinositol-specific)
Horse(100055407) phospholipase C, beta 3 (phosphatidylinositol-specific)
domestic cat(101092961) phospholipase C, beta 3 (phosphatidylinositol-specific)
cow(515669) phospholipase C, beta 3 (phosphatidylinositol-specific)
sheep(101116105) phospholipase C, beta 3 (phosphatidylinositol-specific)
cow(281984) phospholipase C, beta 3 (phosphatidylinositol-specific)
naked mole-rat(101697744) phospholipase C, beta 3 (phosphatidylinositol-specific)
domestic guinea pig(100727662) phospholipase C, beta 3 (phosphatidylinositol-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000932 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000932 Rosetta Predictions human pricing
NM_033350 Rosetta Predictions rat pricing
NM_008874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035466 predicted 1042
2 SASI_Hs01_00035467 predicted 3380
3 SASI_Hs01_00035468 predicted 1381
4 SASI_Hs01_00035469 predicted 1268
5 SASI_Hs01_00035470 predicted 3295
6 SASI_Hs01_00035471 predicted 334
7 SASI_Hs01_00035472 predicted 3288
8 SASI_Hs01_00035473 predicted 690
9 SASI_Hs01_00035474 predicted 3226
10 SASI_Hs01_00035475 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078525 predicted 1290
2 SASI_Rn01_00078527 predicted 439
3 SASI_Rn01_00078528 predicted 2292
4 SASI_Rn01_00078529 predicted 3104
5 SASI_Rn01_00078530 predicted 837
6 SASI_Rn01_00078531 predicted 707
7 SASI_Rn01_00078533 predicted 3397
8 SASI_Rn01_00078534 predicted 2257
9 SASI_Rn02_00265536 predicted 1824
10 SASI_Rn02_00265537 predicted 2421
11 SASI_Rn01_00078526 predicted 3380
12 SASI_Rn01_00078532 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178745 predicted 2686
2 SASI_Mm01_00178746 predicted 2797
3 SASI_Mm01_00178747 predicted 1420
4 SASI_Mm01_00178748 predicted 438
5 SASI_Mm01_00178751 predicted 711
6 SASI_Mm01_00178752 predicted 1381
7 SASI_Mm01_00178753 predicted 532
8 SASI_Mm01_00178754 predicted 2387
9 SASI_Mm02_00314861 predicted 2730
10 SASI_Mm02_00314862 predicted 236
11 SASI_Mm01_00178749 predicted 3494
12 SASI_Mm01_00178750 predicted 3472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000932
VALIDATED
PLCB3 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, beta 3 (phosphatidylinositol-specific)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-3252s1c1
Sequence:CCGGAGAGATGAACGAGAGGGAGAACTCGAGTTCTCCCTCTCGTTCATCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-1767s1c1
Sequence:CCGGGATGTCCACGCTTGTCAACTACTCGAGTAGTTGACAAGCGTGGACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-978s21c1
Sequence:CCGGCTTCATCAACTCCTCGCATAACTCGAGTTATGCGAGGAGTTGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-2252s1c1
Sequence:CCGGTGTTTGGCCTCCCTGTTGATACTCGAGTATCAACAGGGAGGCCAAACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000932.x-1641s1c1
Sequence:CCGGCTATGTTCTTGGACCTGCTGACTCGAGTCAGCAGGTCCAAGAACATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-1767s21c1
Sequence:CCGGGATGTCCACGCTTGTCAACTACTCGAGTAGTTGACAAGCGTGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-1641s21c1
Sequence:CCGGCTATGTTCTTGGACCTGCTGACTCGAGTCAGCAGGTCCAAGAACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-3252s21c1
Sequence:CCGGAGAGATGAACGAGAGGGAGAACTCGAGTTCTCCCTCTCGTTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-2252s21c1
Sequence:CCGGTGTTTGGCCTCCCTGTTGATACTCGAGTATCAACAGGGAGGCCAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000932
VALIDATED
PLCB3 MISSION shRNA shRNA Plasmid DNA
phospholipase C, beta 3 (phosphatidylinositol-specific)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-3252s1c1
Sequence:CCGGAGAGATGAACGAGAGGGAGAACTCGAGTTCTCCCTCTCGTTCATCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-1767s1c1
Sequence:CCGGGATGTCCACGCTTGTCAACTACTCGAGTAGTTGACAAGCGTGGACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-978s21c1
Sequence:CCGGCTTCATCAACTCCTCGCATAACTCGAGTTATGCGAGGAGTTGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-2252s1c1
Sequence:CCGGTGTTTGGCCTCCCTGTTGATACTCGAGTATCAACAGGGAGGCCAAACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000932.x-1641s1c1
Sequence:CCGGCTATGTTCTTGGACCTGCTGACTCGAGTCAGCAGGTCCAAGAACATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-1767s21c1
Sequence:CCGGGATGTCCACGCTTGTCAACTACTCGAGTAGTTGACAAGCGTGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-1641s21c1
Sequence:CCGGCTATGTTCTTGGACCTGCTGACTCGAGTCAGCAGGTCCAAGAACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-3252s21c1
Sequence:CCGGAGAGATGAACGAGAGGGAGAACTCGAGTTCTCCCTCTCGTTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-2252s21c1
Sequence:CCGGTGTTTGGCCTCCCTGTTGATACTCGAGTATCAACAGGGAGGCCAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000932
VALIDATED
PLCB3 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, beta 3 (phosphatidylinositol-specific)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-3252s1c1
Sequence:CCGGAGAGATGAACGAGAGGGAGAACTCGAGTTCTCCCTCTCGTTCATCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-1767s1c1
Sequence:CCGGGATGTCCACGCTTGTCAACTACTCGAGTAGTTGACAAGCGTGGACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-978s21c1
Sequence:CCGGCTTCATCAACTCCTCGCATAACTCGAGTTATGCGAGGAGTTGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000932.x-2252s1c1
Sequence:CCGGTGTTTGGCCTCCCTGTTGATACTCGAGTATCAACAGGGAGGCCAAACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000932.x-1641s1c1
Sequence:CCGGCTATGTTCTTGGACCTGCTGACTCGAGTCAGCAGGTCCAAGAACATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-1767s21c1
Sequence:CCGGGATGTCCACGCTTGTCAACTACTCGAGTAGTTGACAAGCGTGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-1641s21c1
Sequence:CCGGCTATGTTCTTGGACCTGCTGACTCGAGTCAGCAGGTCCAAGAACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-3252s21c1
Sequence:CCGGAGAGATGAACGAGAGGGAGAACTCGAGTTCTCCCTCTCGTTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000932.1-2252s21c1
Sequence:CCGGTGTTTGGCCTCCCTGTTGATACTCGAGTATCAACAGGGAGGCCAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008874
VALIDATED
PLCB3 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, beta 3 (phosphatidylinositol-specific)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008874.3-4040s21c1
Sequence:CCGGCCCATAACATTCACCTAAGATCTCGAGATCTTAGGTGAATGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-3362s21c1
Sequence:CCGGGCTGAATGAAAGGGAGAAGAACTCGAGTTCTTCTCCCTTTCATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008874.2-4040s1c1
Sequence:CCGGCCCATAACATTCACCTAAGATCTCGAGATCTTAGGTGAATGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-2640s1c1
Sequence:CCGGGCTTCTGACTACATCCCAGATCTCGAGATCTGGGATGTAGTCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-177s1c1
Sequence:CCGGCGCGGGAGTAAGTTCATCAAACTCGAGTTTGATGAACTTACTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-721s1c1
Sequence:CCGGCTGATGAGTTTCCCTTGGAAACTCGAGTTTCCAAGGGAAACTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-3362s1c1
Sequence:CCGGGCTGAATGAAAGGGAGAAGAACTCGAGTTCTTCTCCCTTTCATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-2640s21c1
Sequence:CCGGGCTTCTGACTACATCCCAGATCTCGAGATCTGGGATGTAGTCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-721s21c1
Sequence:CCGGCTGATGAGTTTCCCTTGGAAACTCGAGTTTCCAAGGGAAACTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008874
VALIDATED
PLCB3 MISSION shRNA shRNA Plasmid DNA
phospholipase C, beta 3 (phosphatidylinositol-specific)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008874.3-4040s21c1
Sequence:CCGGCCCATAACATTCACCTAAGATCTCGAGATCTTAGGTGAATGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-3362s21c1
Sequence:CCGGGCTGAATGAAAGGGAGAAGAACTCGAGTTCTTCTCCCTTTCATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008874.2-4040s1c1
Sequence:CCGGCCCATAACATTCACCTAAGATCTCGAGATCTTAGGTGAATGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-2640s1c1
Sequence:CCGGGCTTCTGACTACATCCCAGATCTCGAGATCTGGGATGTAGTCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-177s1c1
Sequence:CCGGCGCGGGAGTAAGTTCATCAAACTCGAGTTTGATGAACTTACTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-721s1c1
Sequence:CCGGCTGATGAGTTTCCCTTGGAAACTCGAGTTTCCAAGGGAAACTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-3362s1c1
Sequence:CCGGGCTGAATGAAAGGGAGAAGAACTCGAGTTCTTCTCCCTTTCATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-2640s21c1
Sequence:CCGGGCTTCTGACTACATCCCAGATCTCGAGATCTGGGATGTAGTCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-721s21c1
Sequence:CCGGCTGATGAGTTTCCCTTGGAAACTCGAGTTTCCAAGGGAAACTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008874
VALIDATED
PLCB3 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, beta 3 (phosphatidylinositol-specific)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008874.3-4040s21c1
Sequence:CCGGCCCATAACATTCACCTAAGATCTCGAGATCTTAGGTGAATGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-3362s21c1
Sequence:CCGGGCTGAATGAAAGGGAGAAGAACTCGAGTTCTTCTCCCTTTCATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008874.2-4040s1c1
Sequence:CCGGCCCATAACATTCACCTAAGATCTCGAGATCTTAGGTGAATGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-2640s1c1
Sequence:CCGGGCTTCTGACTACATCCCAGATCTCGAGATCTGGGATGTAGTCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-177s1c1
Sequence:CCGGCGCGGGAGTAAGTTCATCAAACTCGAGTTTGATGAACTTACTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-721s1c1
Sequence:CCGGCTGATGAGTTTCCCTTGGAAACTCGAGTTTCCAAGGGAAACTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008874.2-3362s1c1
Sequence:CCGGGCTGAATGAAAGGGAGAAGAACTCGAGTTCTTCTCCCTTTCATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-2640s21c1
Sequence:CCGGGCTTCTGACTACATCCCAGATCTCGAGATCTGGGATGTAGTCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008874.3-721s21c1
Sequence:CCGGCTGATGAGTTTCCCTTGGAAACTCGAGTTTCCAAGGGAAACTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)