EMAIL THIS PAGE TO A FRIEND

PLCD1

phospholipase C, delta 1

61 Gene Product Result for
Synonyms: NDNC3 PLC-III
UniProtKB ID: P51178, B3KR14, Q86VN8
Gene ID:
Human(5333) Summary: This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(18799) phospholipase C, delta 1
Rat(24655) phospholipase C, delta 1
chicken(420416) phospholipase C, delta 1
Horse(100054233) phospholipase C, delta 1
domestic cat(101087777) phospholipase C, delta 1
dog(485586) phospholipase C, delta 1
cow(790012) 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase delta-1-like
sheep(101110367) phospholipase C, delta 1
cow(281986) phospholipase C, delta 1
naked mole-rat(101715010) phospholipase C, delta 1
domestic guinea pig(100715613) phospholipase C, delta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006225 Rosetta Predictions human pricing
NM_017035 Rosetta Predictions rat pricing
NM_019676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198439 predicted 1169
2 SASI_Hs02_00341139 predicted 2214
3 SASI_Hs01_00198440 predicted 2172
4 SASI_Hs01_00198441 predicted 2283
5 SASI_Hs01_00198442 predicted 1167
6 SASI_Hs01_00198443 predicted 430
7 SASI_Hs01_00198444 predicted 2051
8 SASI_Hs01_00198446 predicted 713
9 SASI_Hs01_00198447 predicted 234
10 SASI_Hs01_00198448 predicted 2135
11 SASI_Hs01_00198445 predicted 2189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040875 predicted 1701
2 SASI_Rn01_00040876 predicted 1366
3 SASI_Rn02_00261217 predicted 411
4 SASI_Rn01_00040879 predicted 2330
5 SASI_Rn01_00040880 predicted 1814
6 SASI_Rn01_00040881 predicted 1271
7 SASI_Rn01_00040882 predicted 1835
8 SASI_Rn02_00261218 predicted 1343
9 SASI_Rn01_00040883 predicted 2361
10 SASI_Rn01_00040884 predicted 2240
11 SASI_Rn01_00040877 predicted 2450
12 SASI_Rn01_00040878 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141271 predicted 2211
2 SASI_Mm01_00141272 predicted 1305
3 SASI_Mm02_00324753 predicted 1152
4 SASI_Mm01_00141273 predicted 2164
5 SASI_Mm01_00141274 predicted 1885
6 SASI_Mm01_00141275 predicted 387
7 SASI_Mm01_00141276 predicted 413
8 SASI_Mm01_00141277 predicted 348
9 SASI_Mm01_00141278 predicted 1723
10 SASI_Mm01_00141279 predicted 2245
11 SASI_Mm01_00141270 predicted 1254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006225
VALIDATED
PLCD1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, delta 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-1148s1c1
Sequence:CCGGCCAATCATCTACCACGGCTATCTCGAGATAGCCGTGGTAGATGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-2545s1c1
Sequence:CCGGGAGCTGTCCTTCATTCCGTTACTCGAGTAACGGAATGAAGGACAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-406s1c1
Sequence:CCGGGCGCAATACACTAGACCTCATCTCGAGATGAGGTCTAGTGTATTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006225.x-1162s1c1
Sequence:CCGGCGGCTATACTTTCACTTCCAACTCGAGTTGGAAGTGAAAGTATAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-911s1c1
Sequence:CCGGGACGGCTTCCTCATGTACTTACTCGAGTAAGTACATGAGGAAGCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-1179s21c1
Sequence:CCGGCAATCATCTACCACGGCTATACTCGAGTATAGCCGTGGTAGATGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-2014s21c1
Sequence:CCGGGCTCAACATCAGGGTCATTTCCTCGAGGAAATGACCCTGATGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-941s21c1
Sequence:CCGGGACGGCTTCCTCATGTACTTACTCGAGTAAGTACATGAGGAAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-1840s21c1
Sequence:CCGGCCAGATCGTGGCCCTGAATTTCTCGAGAAATTCAGGGCCACGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006225.3-2575s21c1
Sequence:CCGGGAGCTGTCCTTCATTCCGTTACTCGAGTAACGGAATGAAGGACAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006225
VALIDATED
PLCD1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, delta 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-1148s1c1
Sequence:CCGGCCAATCATCTACCACGGCTATCTCGAGATAGCCGTGGTAGATGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-2545s1c1
Sequence:CCGGGAGCTGTCCTTCATTCCGTTACTCGAGTAACGGAATGAAGGACAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-406s1c1
Sequence:CCGGGCGCAATACACTAGACCTCATCTCGAGATGAGGTCTAGTGTATTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006225.x-1162s1c1
Sequence:CCGGCGGCTATACTTTCACTTCCAACTCGAGTTGGAAGTGAAAGTATAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-911s1c1
Sequence:CCGGGACGGCTTCCTCATGTACTTACTCGAGTAAGTACATGAGGAAGCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-1179s21c1
Sequence:CCGGCAATCATCTACCACGGCTATACTCGAGTATAGCCGTGGTAGATGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-2014s21c1
Sequence:CCGGGCTCAACATCAGGGTCATTTCCTCGAGGAAATGACCCTGATGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-941s21c1
Sequence:CCGGGACGGCTTCCTCATGTACTTACTCGAGTAAGTACATGAGGAAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-1840s21c1
Sequence:CCGGCCAGATCGTGGCCCTGAATTTCTCGAGAAATTCAGGGCCACGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006225.3-2575s21c1
Sequence:CCGGGAGCTGTCCTTCATTCCGTTACTCGAGTAACGGAATGAAGGACAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006225
VALIDATED
PLCD1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, delta 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-1148s1c1
Sequence:CCGGCCAATCATCTACCACGGCTATCTCGAGATAGCCGTGGTAGATGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-2545s1c1
Sequence:CCGGGAGCTGTCCTTCATTCCGTTACTCGAGTAACGGAATGAAGGACAGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-406s1c1
Sequence:CCGGGCGCAATACACTAGACCTCATCTCGAGATGAGGTCTAGTGTATTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006225.x-1162s1c1
Sequence:CCGGCGGCTATACTTTCACTTCCAACTCGAGTTGGAAGTGAAAGTATAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006225.x-911s1c1
Sequence:CCGGGACGGCTTCCTCATGTACTTACTCGAGTAAGTACATGAGGAAGCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-1179s21c1
Sequence:CCGGCAATCATCTACCACGGCTATACTCGAGTATAGCCGTGGTAGATGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-2014s21c1
Sequence:CCGGGCTCAACATCAGGGTCATTTCCTCGAGGAAATGACCCTGATGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-941s21c1
Sequence:CCGGGACGGCTTCCTCATGTACTTACTCGAGTAAGTACATGAGGAAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006225.3-1840s21c1
Sequence:CCGGCCAGATCGTGGCCCTGAATTTCTCGAGAAATTCAGGGCCACGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006225.3-2575s21c1
Sequence:CCGGGAGCTGTCCTTCATTCCGTTACTCGAGTAACGGAATGAAGGACAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019676
VALIDATED
PLCD1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, delta 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019676.2-2454s21c1
Sequence:CCGGGCGGAGCTTGAGGCCACTGAACTCGAGTTCAGTGGCCTCAAGCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2231s1c1
Sequence:CCGGCCTCCTCTAAGAACGACTTTACTCGAGTAAAGTCGTTCTTAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-1013s1c1
Sequence:CCGGGCCACTACTTAGTGTCTTCTTCTCGAGAAGAAGACACTAAGTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2232s1c1
Sequence:CCGGCTCCTCTAAGAACGACTTTATCTCGAGATAAAGTCGTTCTTAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2111s1c2
Sequence:CCGGGCCGTCAGACAGCAGTTATTACTCGAGTAATAACTGCTGTCTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-1013s21c1
Sequence:CCGGGCCACTACTTAGTGTCTTCTTCTCGAGAAGAAGACACTAAGTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2454s1c2
Sequence:CCGGGCGGAGCTTGAGGCCACTGAACTCGAGTTCAGTGGCCTCAAGCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-2231s21c1
Sequence:CCGGCCTCCTCTAAGAACGACTTTACTCGAGTAAAGTCGTTCTTAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-2111s21c1
Sequence:CCGGGCCGTCAGACAGCAGTTATTACTCGAGTAATAACTGCTGTCTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019676
VALIDATED
PLCD1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, delta 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019676.2-2454s21c1
Sequence:CCGGGCGGAGCTTGAGGCCACTGAACTCGAGTTCAGTGGCCTCAAGCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2231s1c1
Sequence:CCGGCCTCCTCTAAGAACGACTTTACTCGAGTAAAGTCGTTCTTAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-1013s1c1
Sequence:CCGGGCCACTACTTAGTGTCTTCTTCTCGAGAAGAAGACACTAAGTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2232s1c1
Sequence:CCGGCTCCTCTAAGAACGACTTTATCTCGAGATAAAGTCGTTCTTAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2111s1c2
Sequence:CCGGGCCGTCAGACAGCAGTTATTACTCGAGTAATAACTGCTGTCTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-1013s21c1
Sequence:CCGGGCCACTACTTAGTGTCTTCTTCTCGAGAAGAAGACACTAAGTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2454s1c2
Sequence:CCGGGCGGAGCTTGAGGCCACTGAACTCGAGTTCAGTGGCCTCAAGCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-2231s21c1
Sequence:CCGGCCTCCTCTAAGAACGACTTTACTCGAGTAAAGTCGTTCTTAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-2111s21c1
Sequence:CCGGGCCGTCAGACAGCAGTTATTACTCGAGTAATAACTGCTGTCTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019676
VALIDATED
PLCD1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, delta 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019676.2-2454s21c1
Sequence:CCGGGCGGAGCTTGAGGCCACTGAACTCGAGTTCAGTGGCCTCAAGCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2231s1c1
Sequence:CCGGCCTCCTCTAAGAACGACTTTACTCGAGTAAAGTCGTTCTTAGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-1013s1c1
Sequence:CCGGGCCACTACTTAGTGTCTTCTTCTCGAGAAGAAGACACTAAGTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2232s1c1
Sequence:CCGGCTCCTCTAAGAACGACTTTATCTCGAGATAAAGTCGTTCTTAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2111s1c2
Sequence:CCGGGCCGTCAGACAGCAGTTATTACTCGAGTAATAACTGCTGTCTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-1013s21c1
Sequence:CCGGGCCACTACTTAGTGTCTTCTTCTCGAGAAGAAGACACTAAGTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019676.1-2454s1c2
Sequence:CCGGGCGGAGCTTGAGGCCACTGAACTCGAGTTCAGTGGCCTCAAGCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-2231s21c1
Sequence:CCGGCCTCCTCTAAGAACGACTTTACTCGAGTAAAGTCGTTCTTAGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019676.2-2111s21c1
Sequence:CCGGGCCGTCAGACAGCAGTTATTACTCGAGTAATAACTGCTGTCTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)