EMAIL THIS PAGE TO A FRIEND

PLCD3

phospholipase C, delta 3

46 Gene Product Result for
UniProtKB ID: Q8N3E9, Q8TEC1, Q8TF37, Q96FL6
Gene ID:
Human(113026) Summary: This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Mouse(72469) phospholipase C, delta 3
Rat(287745) phospholipase C, delta 3
cow(513057) phospholipase C, delta 3
sheep(101118035) phospholipase C, delta 3
domestic guinea pig(100724912) phospholipase C, delta 3
naked mole-rat(101704621) phospholipase C, delta 3
Domestic Rabbit(100352032) phospholipase C, delta 3
chicken(428279) phospholipase C, delta 3
domestic cat(101086518) phospholipase C, delta 3
dog(490929) phospholipase C, delta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133373 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133373 Rosetta Predictions human pricing
NM_001105845 Rosetta Predictions rat pricing
NM_152813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209736 predicted 1022
2 SASI_Hs01_00209737 predicted 2201
3 SASI_Hs01_00209738 predicted 2005
4 SASI_Hs01_00209739 predicted 1041
5 SASI_Hs01_00209740 predicted 1291
6 SASI_Hs02_00363075 predicted 2473
7 SASI_Hs01_00209742 predicted 1102
8 SASI_Hs01_00209743 predicted 534
9 SASI_Hs01_00209744 predicted 1209
10 SASI_Hs02_00363076 predicted 2212
11 SASI_Hs01_00209741 predicted 2643
12 SASI_Hs01_00209745 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213092 predicted 1535
2 SASI_Rn02_00213093 predicted 1346
3 SASI_Rn02_00213094 predicted 2056
4 SASI_Rn02_00213095 predicted 492
5 SASI_Rn02_00213096 predicted 1291
6 SASI_Rn02_00213097 predicted 1426
7 SASI_Rn02_00213098 predicted 1262
8 SASI_Rn02_00213099 predicted 1365
9 SASI_Rn02_00213100 predicted 956
10 SASI_Rn02_00213101 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342822 predicted 2256
2 SASI_Mm01_00156466 predicted 1976
3 SASI_Mm01_00156467 predicted 1908
4 SASI_Mm01_00156468 predicted 2030
5 SASI_Mm01_00156469 predicted 1161
6 SASI_Mm01_00156471 predicted 480
7 SASI_Mm01_00156472 predicted 366
8 SASI_Mm01_00156473 predicted 2164
9 SASI_Mm01_00156474 predicted 1264
10 SASI_Mm01_00156475 predicted 1831
11 SASI_Mm01_00156470 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152813
VALIDATED
PLCD3 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, delta 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152813.3-2314s21c1
Sequence:CCGGGGTTTGTGGTAGAAGATTATGCTCGAGCATAATCTTCTACCACAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152813.3-2098s21c1
Sequence:CCGGCTCTGGCAATCCAGGTGTTAACTCGAGTTAACACCTGGATTGCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152813.3-2727s21c1
Sequence:CCGGAGATTCCCTGGTCAACTTGAGCTCGAGCTCAAGTTGACCAGGGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152813.1-2731s1c1
Sequence:CCGGCGTAACCTTCATCCCTGAGAACTCGAGTTCTCAGGGATGAAGGTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-936s1c1
Sequence:CCGGCCAGCAGCTTATCCAGACTTACTCGAGTAAGTCTGGATAAGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-1940s1c1
Sequence:CCGGGCTTCCTCATAAACGGGCAATCTCGAGATTGCCCGTTTATGAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152813.1-365s1c1
Sequence:CCGGGCGCAGCTTCTAAGCACATATCTCGAGATATGTGCTTAGAAGCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-1162s1c1
Sequence:CCGGGAGGCTTATATTAGGGCCTTTCTCGAGAAAGGCCCTAATATAAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152813
VALIDATED
PLCD3 MISSION shRNA shRNA Plasmid DNA
phospholipase C, delta 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152813.3-2314s21c1
Sequence:CCGGGGTTTGTGGTAGAAGATTATGCTCGAGCATAATCTTCTACCACAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152813.3-2098s21c1
Sequence:CCGGCTCTGGCAATCCAGGTGTTAACTCGAGTTAACACCTGGATTGCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152813.3-2727s21c1
Sequence:CCGGAGATTCCCTGGTCAACTTGAGCTCGAGCTCAAGTTGACCAGGGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152813.1-2731s1c1
Sequence:CCGGCGTAACCTTCATCCCTGAGAACTCGAGTTCTCAGGGATGAAGGTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-936s1c1
Sequence:CCGGCCAGCAGCTTATCCAGACTTACTCGAGTAAGTCTGGATAAGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-1940s1c1
Sequence:CCGGGCTTCCTCATAAACGGGCAATCTCGAGATTGCCCGTTTATGAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152813.1-365s1c1
Sequence:CCGGGCGCAGCTTCTAAGCACATATCTCGAGATATGTGCTTAGAAGCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-1162s1c1
Sequence:CCGGGAGGCTTATATTAGGGCCTTTCTCGAGAAAGGCCCTAATATAAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152813
VALIDATED
PLCD3 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, delta 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152813.3-2314s21c1
Sequence:CCGGGGTTTGTGGTAGAAGATTATGCTCGAGCATAATCTTCTACCACAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152813.3-2098s21c1
Sequence:CCGGCTCTGGCAATCCAGGTGTTAACTCGAGTTAACACCTGGATTGCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152813.3-2727s21c1
Sequence:CCGGAGATTCCCTGGTCAACTTGAGCTCGAGCTCAAGTTGACCAGGGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152813.1-2731s1c1
Sequence:CCGGCGTAACCTTCATCCCTGAGAACTCGAGTTCTCAGGGATGAAGGTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-936s1c1
Sequence:CCGGCCAGCAGCTTATCCAGACTTACTCGAGTAAGTCTGGATAAGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-1940s1c1
Sequence:CCGGGCTTCCTCATAAACGGGCAATCTCGAGATTGCCCGTTTATGAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152813.1-365s1c1
Sequence:CCGGGCGCAGCTTCTAAGCACATATCTCGAGATATGTGCTTAGAAGCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152813.1-1162s1c1
Sequence:CCGGGAGGCTTATATTAGGGCCTTTCTCGAGAAAGGCCCTAATATAAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133373
PLCD3 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, delta 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133373.3-1789s21c1
Sequence:CCGGAGCGAGCGCAAAGCCAAGAAACTCGAGTTTCTTGGCTTTGCGCTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133373.3-2010s21c1
Sequence:CCGGGCAGTGTGGCTACGTCCTAAACTCGAGTTTAGGACGTAGCCACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-2222s1c1
Sequence:CCGGCGTGCTCAACAATGGCTTCAACTCGAGTTGAAGCCATTGTTGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-2350s1c1
Sequence:CCGGGCCAGTTTACACTGCCTCTTACTCGAGTAAGAGGCAGTGTAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-1874s1c1
Sequence:CCGGGCGGATGAACTCAGCCAACTACTCGAGTAGTTGGCTGAGTTCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-1304s1c1
Sequence:CCGGCCTCACCTCCAAGATTCTCTTCTCGAGAAGAGAATCTTGGAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-749s1c1
Sequence:CCGGCGTGGACATGAACGACATGTACTCGAGTACATGTCGTTCATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133373
PLCD3 MISSION shRNA shRNA Plasmid DNA
phospholipase C, delta 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133373.3-1789s21c1
Sequence:CCGGAGCGAGCGCAAAGCCAAGAAACTCGAGTTTCTTGGCTTTGCGCTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133373.3-2010s21c1
Sequence:CCGGGCAGTGTGGCTACGTCCTAAACTCGAGTTTAGGACGTAGCCACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-2222s1c1
Sequence:CCGGCGTGCTCAACAATGGCTTCAACTCGAGTTGAAGCCATTGTTGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-2350s1c1
Sequence:CCGGGCCAGTTTACACTGCCTCTTACTCGAGTAAGAGGCAGTGTAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-1874s1c1
Sequence:CCGGGCGGATGAACTCAGCCAACTACTCGAGTAGTTGGCTGAGTTCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-1304s1c1
Sequence:CCGGCCTCACCTCCAAGATTCTCTTCTCGAGAAGAGAATCTTGGAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-749s1c1
Sequence:CCGGCGTGGACATGAACGACATGTACTCGAGTACATGTCGTTCATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133373
PLCD3 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, delta 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133373.3-1789s21c1
Sequence:CCGGAGCGAGCGCAAAGCCAAGAAACTCGAGTTTCTTGGCTTTGCGCTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133373.3-2010s21c1
Sequence:CCGGGCAGTGTGGCTACGTCCTAAACTCGAGTTTAGGACGTAGCCACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-2222s1c1
Sequence:CCGGCGTGCTCAACAATGGCTTCAACTCGAGTTGAAGCCATTGTTGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-2350s1c1
Sequence:CCGGGCCAGTTTACACTGCCTCTTACTCGAGTAAGAGGCAGTGTAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-1874s1c1
Sequence:CCGGGCGGATGAACTCAGCCAACTACTCGAGTAGTTGGCTGAGTTCATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-1304s1c1
Sequence:CCGGCCTCACCTCCAAGATTCTCTTCTCGAGAAGAGAATCTTGGAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133373.1-749s1c1
Sequence:CCGGCGTGGACATGAACGACATGTACTCGAGTACATGTCGTTCATGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)