EMAIL THIS PAGE TO A FRIEND

PLCD4

phospholipase C, delta 4

73 Gene Product Result for
UniProtKB ID: Q9BRC7, Q53FS8
Gene ID:
Human(84812) Summary: This gene encodes a member of the delta class of phospholipase C enzymes. Phospholipase C enzymes play a critical role in many cellular processes by hydrolyzing phosphatidylinositol 4,5-bisphosphate into two intracellular second messengers, inositol 1,4,5-trisphosphate and diacylglycerol. Expression of this gene may be a marker for cancer. [provided by RefSeq, Jan 2011]
Mouse(18802) phospholipase C, delta 4
Rat(140693) phospholipase C, delta 4
chicken(420029) phospholipase C, delta 4
domestic cat(101090455) phospholipase C, delta 4
dog(478910) phospholipase C, delta 4
Domestic Rabbit(100347485) phospholipase C, delta 4
naked mole-rat(101704999) phospholipase C, delta 4
domestic guinea pig(100726088) phospholipase C, delta 4
cow(540771) phospholipase C, delta 4
sheep(101111344) phospholipase C, delta 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052601 MISSION® esiRNA esiRNA human PLCD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032726 Rosetta Predictions human pricing
NM_080688 Rosetta Predictions rat pricing
NM_001081456 Rosetta Predictions mouse pricing
NM_148937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046438 predicted 1999
2 SASI_Hs01_00046439 predicted 772
3 SASI_Hs02_00360256 predicted 1824
4 SASI_Hs01_00046440 predicted 1695
5 SASI_Hs01_00046441 predicted 661
6 SASI_Hs01_00046442 predicted 711
7 SASI_Hs01_00046443 predicted 1798
8 SASI_Hs02_00360257 predicted 1738
9 SASI_Hs01_00046444 predicted 1293
10 SASI_Hs01_00046446 predicted 1016
11 SASI_Hs01_00046445 predicted 294
12 SASI_Hs01_00046447 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038130 predicted 657
2 SASI_Rn01_00038132 predicted 719
3 SASI_Rn01_00038133 predicted 1992
4 SASI_Rn01_00038134 predicted 689
5 SASI_Rn01_00038135 predicted 705
6 SASI_Rn01_00038136 predicted 1754
7 SASI_Rn01_00038137 predicted 890
8 SASI_Rn02_00267263 predicted 738
9 SASI_Rn01_00038139 predicted 361
10 SASI_Rn02_00267264 predicted 2017
11 SASI_Rn01_00038131 predicted 1637
12 SASI_Rn01_00038138 predicted 2181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298436 predicted 848
2 SASI_Mm02_00298437 predicted 392
3 SASI_Mm02_00298438 predicted 711
4 SASI_Mm02_00298439 predicted 775
5 SASI_Mm02_00298440 predicted 565
6 SASI_Mm02_00298441 predicted 744
7 SASI_Mm02_00298442 predicted 923
8 SASI_Mm02_00298443 predicted 2028
9 SASI_Mm02_00298444 predicted 563
10 SASI_Mm02_00298445 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161600 predicted 1000
2 SASI_Mm01_00161601 predicted 541
3 SASI_Mm02_00342745 predicted 1424
4 SASI_Mm01_00161602 predicted 863
5 SASI_Mm01_00161603 predicted 923
6 SASI_Mm01_00161607 predicted 717
7 SASI_Mm01_00161604 predicted 899
8 SASI_Mm01_00161605 predicted 1071
9 SASI_Mm01_00161606 predicted 2275
10 SASI_Mm02_00342746 predicted 712
11 SASI_Mm01_00161608 predicted 1879
12 SASI_Mm01_00161609 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032726
PLCD4 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, delta 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-780s1c1
Sequence:CCGGCGTACAGTTCTATAAGGCATTCTCGAGAATGCCTTATAGAACTGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-684s1c1
Sequence:CCGGGCACCTAATGAATGTGGAAATCTCGAGATTTCCACATTCATTAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032726.2-2781s1c1
Sequence:CCGGCGACATCTACAACTAATCTTTCTCGAGAAAGATTAGTTGTAGATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-2113s1c1
Sequence:CCGGCCCAAAGTGGACAAGACCAAACTCGAGTTTGGTCTTGTCCACTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-1736s21c1
Sequence:CCGGACTACCACTTCTACGAGATATCTCGAGATATCTCGTAGAAGTGGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-1145s21c1
Sequence:CCGGAGAGCAGCGTCGAGGGATATACTCGAGTATATCCCTCGACGCTGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-2007s21c1
Sequence:CCGGGCCAGACTTCCTGCGTGATATCTCGAGATATCACGCAGGAAGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032726.2-2690s21c1
Sequence:CCGGCATAAGCCTTTGGTATCTTTCCTCGAGGAAAGATACCAAAGGCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-388s21c1
Sequence:CCGGGATGTGGAGACAATACGTAATCTCGAGATTACGTATTGTCTCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032726
PLCD4 MISSION shRNA shRNA Plasmid DNA
phospholipase C, delta 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-780s1c1
Sequence:CCGGCGTACAGTTCTATAAGGCATTCTCGAGAATGCCTTATAGAACTGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-684s1c1
Sequence:CCGGGCACCTAATGAATGTGGAAATCTCGAGATTTCCACATTCATTAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032726.2-2781s1c1
Sequence:CCGGCGACATCTACAACTAATCTTTCTCGAGAAAGATTAGTTGTAGATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-2113s1c1
Sequence:CCGGCCCAAAGTGGACAAGACCAAACTCGAGTTTGGTCTTGTCCACTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-1736s21c1
Sequence:CCGGACTACCACTTCTACGAGATATCTCGAGATATCTCGTAGAAGTGGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-1145s21c1
Sequence:CCGGAGAGCAGCGTCGAGGGATATACTCGAGTATATCCCTCGACGCTGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-2007s21c1
Sequence:CCGGGCCAGACTTCCTGCGTGATATCTCGAGATATCACGCAGGAAGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032726.2-2690s21c1
Sequence:CCGGCATAAGCCTTTGGTATCTTTCCTCGAGGAAAGATACCAAAGGCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-388s21c1
Sequence:CCGGGATGTGGAGACAATACGTAATCTCGAGATTACGTATTGTCTCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032726
PLCD4 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, delta 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-780s1c1
Sequence:CCGGCGTACAGTTCTATAAGGCATTCTCGAGAATGCCTTATAGAACTGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-684s1c1
Sequence:CCGGGCACCTAATGAATGTGGAAATCTCGAGATTTCCACATTCATTAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032726.2-2781s1c1
Sequence:CCGGCGACATCTACAACTAATCTTTCTCGAGAAAGATTAGTTGTAGATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032726.2-2113s1c1
Sequence:CCGGCCCAAAGTGGACAAGACCAAACTCGAGTTTGGTCTTGTCCACTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-1736s21c1
Sequence:CCGGACTACCACTTCTACGAGATATCTCGAGATATCTCGTAGAAGTGGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-1145s21c1
Sequence:CCGGAGAGCAGCGTCGAGGGATATACTCGAGTATATCCCTCGACGCTGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-2007s21c1
Sequence:CCGGGCCAGACTTCCTGCGTGATATCTCGAGATATCACGCAGGAAGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032726.2-2690s21c1
Sequence:CCGGCATAAGCCTTTGGTATCTTTCCTCGAGGAAAGATACCAAAGGCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032726.2-388s21c1
Sequence:CCGGGATGTGGAGACAATACGTAATCTCGAGATTACGTATTGTCTCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148937
PLCD4 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, delta 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148937.1-2660s1c1
Sequence:CCGGGCCAGCCAAAGGATCAATGAACTCGAGTTCATTGATCCTTTGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-1012s1c1
Sequence:CCGGCCTCCCTATCTACCAGGATATCTCGAGATATCCTGGTAGATAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-2308s1c1
Sequence:CCGGCCATGTGGAGAACAATGGTATCTCGAGATACCATTGTTCTCCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-1194s1c1
Sequence:CCGGCTGTTGTTTATCATGGGCATACTCGAGTATGCCCATGATAAACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-2309s1c1
Sequence:CCGGCATGTGGAGAACAATGGTATTCTCGAGAATACCATTGTTCTCCACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148937
PLCD4 MISSION shRNA shRNA Plasmid DNA
phospholipase C, delta 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148937.1-2660s1c1
Sequence:CCGGGCCAGCCAAAGGATCAATGAACTCGAGTTCATTGATCCTTTGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-1012s1c1
Sequence:CCGGCCTCCCTATCTACCAGGATATCTCGAGATATCCTGGTAGATAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-2308s1c1
Sequence:CCGGCCATGTGGAGAACAATGGTATCTCGAGATACCATTGTTCTCCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-1194s1c1
Sequence:CCGGCTGTTGTTTATCATGGGCATACTCGAGTATGCCCATGATAAACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-2309s1c1
Sequence:CCGGCATGTGGAGAACAATGGTATTCTCGAGAATACCATTGTTCTCCACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148937
PLCD4 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, delta 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148937.1-2660s1c1
Sequence:CCGGGCCAGCCAAAGGATCAATGAACTCGAGTTCATTGATCCTTTGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-1012s1c1
Sequence:CCGGCCTCCCTATCTACCAGGATATCTCGAGATATCCTGGTAGATAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-2308s1c1
Sequence:CCGGCCATGTGGAGAACAATGGTATCTCGAGATACCATTGTTCTCCACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-1194s1c1
Sequence:CCGGCTGTTGTTTATCATGGGCATACTCGAGTATGCCCATGATAAACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148937.1-2309s1c1
Sequence:CCGGCATGTGGAGAACAATGGTATTCTCGAGAATACCATTGTTCTCCACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)