EMAIL THIS PAGE TO A FRIEND

PLCE1

phospholipase C, epsilon 1

66 Gene Product Result for
Synonyms: NPHS3 PLCE PPLC
Gene ID:
Human(51196) Summary: This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Mouse(74055) phospholipase C, epsilon 1
Rat(114633) phospholipase C, epsilon 1
Zebrafish(568288) phospholipase C, epsilon 1
chicken(428962) phospholipase C, epsilon 1
dog(486808) phospholipase C, epsilon 1
Horse(100061676) phospholipase C, epsilon 1
domestic cat(101088695) phospholipase C, epsilon 1
cow(519037) phospholipase C, epsilon 1
sheep(101105703) phospholipase C, epsilon 1
domestic guinea pig(100721203) phospholipase C, epsilon 1
naked mole-rat(101706315) phospholipase C, epsilon 1
Domestic Rabbit(100344504) phospholipase C, epsilon 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016341 Rosetta Predictions human pricing
NM_053758 Rosetta Predictions rat pricing
NM_019588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101525 predicted 5524
2 SASI_Hs01_00101527 predicted 3396
3 SASI_Hs01_00101528 predicted 3739
4 SASI_Hs01_00101531 predicted 3626
5 SASI_Hs02_00349295 predicted 787
6 SASI_Hs01_00101532 predicted 4818
7 SASI_Hs02_00349296 predicted 4647
8 SASI_Hs01_00101534 predicted 3102
9 SASI_Hs02_00349297 predicted 2260
10 SASI_Hs02_00349298 predicted 3932
11 SASI_Hs01_00101526 predicted 5733
12 SASI_Hs01_00101529 predicted 5474
13 SASI_Hs01_00101530 predicted 384
14 SASI_Hs01_00101533 predicted 4992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100391 predicted 4429
2 SASI_Rn01_00100392 predicted 5747
3 SASI_Rn01_00100393 predicted 6104
4 SASI_Rn02_00266544 predicted 7418
5 SASI_Rn01_00100395 predicted 5754
6 SASI_Rn01_00100396 predicted 5265
7 SASI_Rn02_00266545 predicted 5924
8 SASI_Rn01_00100397 predicted 7179
9 SASI_Rn01_00100398 predicted 6142
10 SASI_Rn01_00100400 predicted 6171
11 SASI_Rn01_00100394 predicted 1484
12 SASI_Rn01_00100399 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032179 predicted 609
2 SASI_Mm01_00032180 predicted 5644
3 SASI_Mm02_00324660 predicted 4902
4 SASI_Mm01_00032182 predicted 5667
5 SASI_Mm01_00032183 predicted 261
6 SASI_Mm01_00032184 predicted 362
7 SASI_Mm01_00032185 predicted 3632
8 SASI_Mm01_00032186 predicted 1390
9 SASI_Mm01_00032187 predicted 5249
10 SASI_Mm02_00324661 predicted 3061
11 SASI_Mm01_00032181 predicted 3936
12 SASI_Mm01_00032188 predicted 5932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016341
VALIDATED
PLCE1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, epsilon 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-3633s21c1
Sequence:CCGGGCGGATTATTGGAACTCACTACTCGAGTAGTGAGTTCCAATAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-4977s21c1
Sequence:CCGGCCATCATTTATCATGGACATACTCGAGTATGTCCATGATAAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016341.2-5714s1c1
Sequence:CCGGGCTGCAATGTTTGAGGCAAATCTCGAGATTTGCCTCAAACATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016341.2-3234s1c1
Sequence:CCGGGCGGATTATTGGAACTCACTACTCGAGTAGTGAGTTCCAATAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016341.2-4578s1c1
Sequence:CCGGCCATCATTTATCATGGACATACTCGAGTATGTCCATGATAAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016341.2-7328s1c1
Sequence:CCGGCCAACCAATTTACTGATGAATCTCGAGATTCATCAGTAAATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016341.3-7728s21c1
Sequence:CCGGCCAACCAATTTACTGATGAATCTCGAGATTCATCAGTAAATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-6113s21c1
Sequence:CCGGGCTGCAATGTTTGAGGCAAATCTCGAGATTTGCCTCAAACATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-1599s21c1
Sequence:CCGGCCACTTTGTTAGTCAGGAGATCTCGAGATCTCCTGACTAACAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016341
VALIDATED
PLCE1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, epsilon 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-3633s21c1
Sequence:CCGGGCGGATTATTGGAACTCACTACTCGAGTAGTGAGTTCCAATAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-4977s21c1
Sequence:CCGGCCATCATTTATCATGGACATACTCGAGTATGTCCATGATAAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016341.2-5714s1c1
Sequence:CCGGGCTGCAATGTTTGAGGCAAATCTCGAGATTTGCCTCAAACATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016341.2-3234s1c1
Sequence:CCGGGCGGATTATTGGAACTCACTACTCGAGTAGTGAGTTCCAATAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016341.2-4578s1c1
Sequence:CCGGCCATCATTTATCATGGACATACTCGAGTATGTCCATGATAAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016341.2-7328s1c1
Sequence:CCGGCCAACCAATTTACTGATGAATCTCGAGATTCATCAGTAAATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016341.3-7728s21c1
Sequence:CCGGCCAACCAATTTACTGATGAATCTCGAGATTCATCAGTAAATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-6113s21c1
Sequence:CCGGGCTGCAATGTTTGAGGCAAATCTCGAGATTTGCCTCAAACATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-1599s21c1
Sequence:CCGGCCACTTTGTTAGTCAGGAGATCTCGAGATCTCCTGACTAACAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016341
VALIDATED
PLCE1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, epsilon 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-3633s21c1
Sequence:CCGGGCGGATTATTGGAACTCACTACTCGAGTAGTGAGTTCCAATAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-4977s21c1
Sequence:CCGGCCATCATTTATCATGGACATACTCGAGTATGTCCATGATAAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016341.2-5714s1c1
Sequence:CCGGGCTGCAATGTTTGAGGCAAATCTCGAGATTTGCCTCAAACATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016341.2-3234s1c1
Sequence:CCGGGCGGATTATTGGAACTCACTACTCGAGTAGTGAGTTCCAATAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016341.2-4578s1c1
Sequence:CCGGCCATCATTTATCATGGACATACTCGAGTATGTCCATGATAAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016341.2-7328s1c1
Sequence:CCGGCCAACCAATTTACTGATGAATCTCGAGATTCATCAGTAAATTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016341.3-7728s21c1
Sequence:CCGGCCAACCAATTTACTGATGAATCTCGAGATTCATCAGTAAATTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-6113s21c1
Sequence:CCGGGCTGCAATGTTTGAGGCAAATCTCGAGATTTGCCTCAAACATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016341.3-1599s21c1
Sequence:CCGGCCACTTTGTTAGTCAGGAGATCTCGAGATCTCCTGACTAACAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019588
PLCE1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, epsilon 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-5915s1c1
Sequence:CCGGCCACAATGAAATCTTGGAAATCTCGAGATTTCCAAGATTTCATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-610s1c1
Sequence:CCGGCGGCGGTATTTCACTTCCATTCTCGAGAATGGAAGTGAAATACCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-4347s1c1
Sequence:CCGGCCCATCATCTATCATGGGCATCTCGAGATGCCCATGATAGATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-1297s1c1
Sequence:CCGGCGGTTGGATCTCTTCTCCATTCTCGAGAATGGAGAAGAGATCCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019588.1-7403s1c1
Sequence:CCGGGCATCCTTCAAGTGTTTCAATCTCGAGATTGAAACACTTGAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019588
PLCE1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, epsilon 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-5915s1c1
Sequence:CCGGCCACAATGAAATCTTGGAAATCTCGAGATTTCCAAGATTTCATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-610s1c1
Sequence:CCGGCGGCGGTATTTCACTTCCATTCTCGAGAATGGAAGTGAAATACCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-4347s1c1
Sequence:CCGGCCCATCATCTATCATGGGCATCTCGAGATGCCCATGATAGATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-1297s1c1
Sequence:CCGGCGGTTGGATCTCTTCTCCATTCTCGAGAATGGAGAAGAGATCCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019588.1-7403s1c1
Sequence:CCGGGCATCCTTCAAGTGTTTCAATCTCGAGATTGAAACACTTGAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019588
PLCE1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, epsilon 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-5915s1c1
Sequence:CCGGCCACAATGAAATCTTGGAAATCTCGAGATTTCCAAGATTTCATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-610s1c1
Sequence:CCGGCGGCGGTATTTCACTTCCATTCTCGAGAATGGAAGTGAAATACCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-4347s1c1
Sequence:CCGGCCCATCATCTATCATGGGCATCTCGAGATGCCCATGATAGATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019588.1-1297s1c1
Sequence:CCGGCGGTTGGATCTCTTCTCCATTCTCGAGAATGGAGAAGAGATCCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019588.1-7403s1c1
Sequence:CCGGGCATCCTTCAAGTGTTTCAATCTCGAGATTGAAACACTTGAAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)