EMAIL THIS PAGE TO A FRIEND

PLCH1

phospholipase C, eta 1

93 Gene Product Result for
Synonyms: PLCL3
Gene ID:
Human(23007) Summary: PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]
Mouse(269437) phospholipase C, eta 1
Rat(310463) phospholipase C, eta 1
chicken(425030) phospholipase C, eta 1
dog(100684810) phospholipase C, eta 1
Horse(100049953) phospholipase C, eta 1
domestic cat(101087261) phospholipase C, eta 1
naked mole-rat(101717211) phospholipase C, eta 1
Domestic Rabbit(100358542) phospholipase C, eta 1
domestic guinea pig(100726419) phospholipase C, eta 1
cow(513565) phospholipase C, eta 1
sheep(101112368) phospholipase C, eta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_042635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_042635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_042635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014996 Rosetta Predictions human pricing
XM_001059231 Rosetta Predictions rat pricing
XM_227208 Rosetta Predictions rat pricing
NM_183191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241226 predicted 2800
2 SASI_Hs01_00241228 predicted 448
3 SASI_Hs01_00241229 predicted 3191
4 SASI_Hs01_00241230 predicted 1111
5 SASI_Hs01_00241231 predicted 1014
6 SASI_Hs01_00241233 predicted 4559
7 SASI_Hs02_00346762 predicted 2777
8 SASI_Hs01_00241234 predicted 4060
9 SASI_Hs01_00241235 predicted 3659
10 SASI_Hs02_00346763 predicted 2088
11 SASI_Hs01_00241227 predicted 3523
12 SASI_Hs01_00241232 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292534 predicted 4600
2 SASI_Rn02_00292535 predicted 890
3 SASI_Rn02_00292536 predicted 4269
4 SASI_Rn02_00292537 predicted 2474
5 SASI_Rn02_00292538 predicted 592
6 SASI_Rn02_00292539 predicted 2913
7 SASI_Rn02_00292540 predicted 3480
8 SASI_Rn02_00292541 predicted 1395
9 SASI_Rn02_00292542 predicted 3668
10 SASI_Rn02_00292543 predicted 3836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384176 predicted 4673
2 SASI_Rn02_00384177 predicted 4598
3 SASI_Rn02_00384178 predicted 885
4 SASI_Rn02_00384179 predicted 1192
5 SASI_Rn02_00384180 predicted 4268
6 SASI_Rn02_00384181 predicted 598
7 SASI_Rn02_00384182 predicted 4152
8 SASI_Rn02_00384183 predicted 3488
9 SASI_Rn02_00384184 predicted 1397
10 SASI_Rn02_00384185 predicted 3670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189660 predicted 4241
2 SASI_Mm01_00189661 predicted 1392
3 SASI_Mm01_00189662 predicted 1739
4 SASI_Mm01_00189663 predicted 4095
5 SASI_Mm01_00189664 predicted 892
6 SASI_Mm01_00189665 predicted 4690
7 SASI_Mm01_00189666 predicted 648
8 SASI_Mm01_00189667 predicted 1531
9 SASI_Mm01_00189668 predicted 4635
10 SASI_Mm02_00350309 predicted 1188
11 SASI_Mm01_00189659 predicted 4141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183191
VALIDATED
PLCH1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, eta 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183191.1-5020s1c1
Sequence:CCGGGCAGCGAAGATAAACCCGAAACTCGAGTTTCGGGTTTATCTTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-3554s1c1
Sequence:CCGGCGTGACTTTAACAAATGAGAACTCGAGTTCTCATTTGTTAAAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183191.1-5852s1c1
Sequence:CCGGCCGACTTTAATCCCAGTAGAACTCGAGTTCTACTGGGATTAAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-1626s1c1
Sequence:CCGGGCGTTACTCAAGGCTACACATCTCGAGATGTGTAGCCTTGAGTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-2731s1c1
Sequence:CCGGCGCATTATGTTCGGAAGCGATCTCGAGATCGCTTCCGAACATAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-2632s21c1
Sequence:CCGGTAACCATCAATGAGATCTTTGCTCGAGCAAAGATCTCATTGATGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5096s21c1
Sequence:CCGGACTCTAGAAGATGTTAGATTTCTCGAGAAATCTAACATCTTCTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5545s21c1
Sequence:CCGGGTGGTTACATTGCCCTTTATGCTCGAGCATAAAGGGCAATGTAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5203s21c1
Sequence:CCGGCATGCATTTGTATATAGATTCCTCGAGGAATCTATATACAAATGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-925s21c1
Sequence:CCGGGCCCTGCCTGTGACGTATTTACTCGAGTAAATACGTCACAGGCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-3915s21c1
Sequence:CCGGGATGCTTCTCCTGGTCAATTTCTCGAGAAATTGACCAGGAGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183191
VALIDATED
PLCH1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, eta 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183191.1-5020s1c1
Sequence:CCGGGCAGCGAAGATAAACCCGAAACTCGAGTTTCGGGTTTATCTTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-3554s1c1
Sequence:CCGGCGTGACTTTAACAAATGAGAACTCGAGTTCTCATTTGTTAAAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183191.1-5852s1c1
Sequence:CCGGCCGACTTTAATCCCAGTAGAACTCGAGTTCTACTGGGATTAAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-1626s1c1
Sequence:CCGGGCGTTACTCAAGGCTACACATCTCGAGATGTGTAGCCTTGAGTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-2731s1c1
Sequence:CCGGCGCATTATGTTCGGAAGCGATCTCGAGATCGCTTCCGAACATAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-2632s21c1
Sequence:CCGGTAACCATCAATGAGATCTTTGCTCGAGCAAAGATCTCATTGATGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5096s21c1
Sequence:CCGGACTCTAGAAGATGTTAGATTTCTCGAGAAATCTAACATCTTCTAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5545s21c1
Sequence:CCGGGTGGTTACATTGCCCTTTATGCTCGAGCATAAAGGGCAATGTAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5203s21c1
Sequence:CCGGCATGCATTTGTATATAGATTCCTCGAGGAATCTATATACAAATGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-925s21c1
Sequence:CCGGGCCCTGCCTGTGACGTATTTACTCGAGTAAATACGTCACAGGCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-3915s21c1
Sequence:CCGGGATGCTTCTCCTGGTCAATTTCTCGAGAAATTGACCAGGAGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183191
VALIDATED
PLCH1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, eta 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183191.1-5020s1c1
Sequence:CCGGGCAGCGAAGATAAACCCGAAACTCGAGTTTCGGGTTTATCTTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-3554s1c1
Sequence:CCGGCGTGACTTTAACAAATGAGAACTCGAGTTCTCATTTGTTAAAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183191.1-5852s1c1
Sequence:CCGGCCGACTTTAATCCCAGTAGAACTCGAGTTCTACTGGGATTAAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-1626s1c1
Sequence:CCGGGCGTTACTCAAGGCTACACATCTCGAGATGTGTAGCCTTGAGTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183191.1-2731s1c1
Sequence:CCGGCGCATTATGTTCGGAAGCGATCTCGAGATCGCTTCCGAACATAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-2632s21c1
Sequence:CCGGTAACCATCAATGAGATCTTTGCTCGAGCAAAGATCTCATTGATGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5096s21c1
Sequence:CCGGACTCTAGAAGATGTTAGATTTCTCGAGAAATCTAACATCTTCTAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5545s21c1
Sequence:CCGGGTGGTTACATTGCCCTTTATGCTCGAGCATAAAGGGCAATGTAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183191.2-5203s21c1
Sequence:CCGGCATGCATTTGTATATAGATTCCTCGAGGAATCTATATACAAATGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-925s21c1
Sequence:CCGGGCCCTGCCTGTGACGTATTTACTCGAGTAAATACGTCACAGGCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183191.2-3915s21c1
Sequence:CCGGGATGCTTCTCCTGGTCAATTTCTCGAGAAATTGACCAGGAGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_042635
VALIDATED
PLCH1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, eta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:XM_042635.5-2460s1c1
Sequence:CCGGCGAGCCAAATTCAAGGCAAATCTCGAGATTTGCCTTGAATTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:XM_042635.5-1938s1c1
Sequence:CCGGGCCACGCATGAAGGCTTAAATCTCGAGATTTAAGCCTTCATGCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-3435s1c1
Sequence:CCGGCCCAGACAGTTAGAATGTGTACTCGAGTACACATTCTAACTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-1234s1c1
Sequence:CCGGCCTGTGACATATTTAACCCATCTCGAGATGGGTTAAATATGTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-2357s1c1
Sequence:CCGGCCGCATTGATTCCAGTAACTTCTCGAGAAGTTACTGGAATCAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_042635
VALIDATED
PLCH1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, eta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:XM_042635.5-2460s1c1
Sequence:CCGGCGAGCCAAATTCAAGGCAAATCTCGAGATTTGCCTTGAATTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:XM_042635.5-1938s1c1
Sequence:CCGGGCCACGCATGAAGGCTTAAATCTCGAGATTTAAGCCTTCATGCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-3435s1c1
Sequence:CCGGCCCAGACAGTTAGAATGTGTACTCGAGTACACATTCTAACTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-1234s1c1
Sequence:CCGGCCTGTGACATATTTAACCCATCTCGAGATGGGTTAAATATGTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-2357s1c1
Sequence:CCGGCCGCATTGATTCCAGTAACTTCTCGAGAAGTTACTGGAATCAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_042635
VALIDATED
PLCH1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, eta 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:XM_042635.5-2460s1c1
Sequence:CCGGCGAGCCAAATTCAAGGCAAATCTCGAGATTTGCCTTGAATTTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:XM_042635.5-1938s1c1
Sequence:CCGGGCCACGCATGAAGGCTTAAATCTCGAGATTTAAGCCTTCATGCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-3435s1c1
Sequence:CCGGCCCAGACAGTTAGAATGTGTACTCGAGTACACATTCTAACTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-1234s1c1
Sequence:CCGGCCTGTGACATATTTAACCCATCTCGAGATGGGTTAAATATGTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042635.5-2357s1c1
Sequence:CCGGCCGCATTGATTCCAGTAACTTCTCGAGAAGTTACTGGAATCAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)