EMAIL THIS PAGE TO A FRIEND

PLCL2

phospholipase C-like 2

111 Gene Product Result for
Synonyms: PLCE2
UniProtKB ID: Q9UPR0, A8K5V4, Q8N498, Q9H8L0, Q9UFP9
Gene ID:
Mouse(224860) phospholipase C-like 2
Rat(301173) phospholipase C-like 2
cow(510408) phospholipase C-like 2
sheep(101114488) phospholipase C-like 2
naked mole-rat(101724164) phospholipase C-like 2
Zebrafish(100334276) phospholipase C-like 2
chicken(420645) phospholipase C-like 2
Horse(100063395) phospholipase C-like 2
domestic cat(101097754) phospholipase C-like 2
dog(485652) phospholipase C-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015184 Rosetta Predictions human pricing
NM_001106880 Rosetta Predictions rat pricing
NM_013880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245592 predicted 1063
2 SASI_Hs02_00347227 predicted 707
3 SASI_Hs02_00347228 predicted 1566
4 SASI_Hs01_00245593 predicted 3203
5 SASI_Hs01_00245594 predicted 1089
6 SASI_Hs01_00245595 predicted 1392
7 SASI_Hs01_00245597 predicted 3309
8 SASI_Hs01_00245599 predicted 2019
9 SASI_Hs02_00347229 predicted 2938
10 SASI_Hs01_00245600 predicted 574
11 SASI_Hs01_00245596 predicted 349
12 SASI_Hs01_00245598 predicted 3263
13 SASI_Hs01_00245601 predicted 3106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223316 predicted 650
2 SASI_Rn02_00223317 predicted 3415
3 SASI_Rn02_00223318 predicted 839
4 SASI_Rn02_00223319 predicted 2468
5 SASI_Rn02_00223320 predicted 1068
6 SASI_Rn02_00223321 predicted 722
7 SASI_Rn02_00223322 predicted 1171
8 SASI_Rn02_00223323 predicted 950
9 SASI_Rn02_00223324 predicted 901
10 SASI_Rn02_00223325 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192222 predicted 629
2 SASI_Mm01_00192223 predicted 2302
3 SASI_Mm01_00192224 predicted 3345
4 SASI_Mm01_00192225 predicted 1697
5 SASI_Mm01_00192226 predicted 1876
6 SASI_Mm01_00192227 predicted 633
7 SASI_Mm02_00322905 predicted 853
8 SASI_Mm02_00322906 predicted 1275
9 SASI_Mm01_00192228 predicted 1144
10 SASI_Mm01_00192229 predicted 3372
11 SASI_Mm01_00192230 predicted 1380
12 SASI_Mm01_00192231 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013880
PLCL2 MISSION shRNA Bacterial Glycerol Stock
phospholipase C-like 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013880.3-3596s21c1
Sequence:CCGGCCCACGTGTGAAGGCAAATAACTCGAGTTATTTGCCTTCACACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013880.3-3848s21c1
Sequence:CCGGCGTGCTTGCTGAGCCATATTTCTCGAGAAATATGGCTCAGCAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-1604s21c1
Sequence:CCGGCCTCTCATCTTATGTTTAGAACTCGAGTTCTAAACATAAGATGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-643s1c1
Sequence:CCGGCCAGAATTTACCATCGGTATTCTCGAGAATACCGATGGTAAATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2404s21c1
Sequence:CCGGCCCTTATGTCTATGTGGAAATCTCGAGATTTCCACATAGACATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2010s21c1
Sequence:CCGGATGAAGTACTTGCGAGTAAATCTCGAGATTTACTCGCAAGTACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1716s1c1
Sequence:CCGGCCTCTCATCTTATGTTTAGAACTCGAGTTCTAAACATAAGATGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1410s1c1
Sequence:CCGGCCTGATTGTTACATCTTTGATCTCGAGATCAAAGATGTAACAATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-2516s1c1
Sequence:CCGGCCCTTATGTCTATGTGGAAATCTCGAGATTTCCACATAGACATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1055s1c1
Sequence:CCGGCCAGTGTATCAGAAACCTCAACTCGAGTTGAGGTTTCTGATACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2686s21c1
Sequence:CCGGGTTCGTCCACGTGGCTATTACCTCGAGGTAATAGCCACGTGGACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013880
PLCL2 MISSION shRNA shRNA Plasmid DNA
phospholipase C-like 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013880.3-3596s21c1
Sequence:CCGGCCCACGTGTGAAGGCAAATAACTCGAGTTATTTGCCTTCACACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013880.3-3848s21c1
Sequence:CCGGCGTGCTTGCTGAGCCATATTTCTCGAGAAATATGGCTCAGCAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-1604s21c1
Sequence:CCGGCCTCTCATCTTATGTTTAGAACTCGAGTTCTAAACATAAGATGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-643s1c1
Sequence:CCGGCCAGAATTTACCATCGGTATTCTCGAGAATACCGATGGTAAATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2404s21c1
Sequence:CCGGCCCTTATGTCTATGTGGAAATCTCGAGATTTCCACATAGACATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2010s21c1
Sequence:CCGGATGAAGTACTTGCGAGTAAATCTCGAGATTTACTCGCAAGTACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1716s1c1
Sequence:CCGGCCTCTCATCTTATGTTTAGAACTCGAGTTCTAAACATAAGATGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1410s1c1
Sequence:CCGGCCTGATTGTTACATCTTTGATCTCGAGATCAAAGATGTAACAATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-2516s1c1
Sequence:CCGGCCCTTATGTCTATGTGGAAATCTCGAGATTTCCACATAGACATAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1055s1c1
Sequence:CCGGCCAGTGTATCAGAAACCTCAACTCGAGTTGAGGTTTCTGATACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2686s21c1
Sequence:CCGGGTTCGTCCACGTGGCTATTACCTCGAGGTAATAGCCACGTGGACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013880
PLCL2 MISSION shRNA Lentiviral Transduction Particles
phospholipase C-like 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013880.3-3596s21c1
Sequence:CCGGCCCACGTGTGAAGGCAAATAACTCGAGTTATTTGCCTTCACACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013880.3-3848s21c1
Sequence:CCGGCGTGCTTGCTGAGCCATATTTCTCGAGAAATATGGCTCAGCAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-1604s21c1
Sequence:CCGGCCTCTCATCTTATGTTTAGAACTCGAGTTCTAAACATAAGATGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-643s1c1
Sequence:CCGGCCAGAATTTACCATCGGTATTCTCGAGAATACCGATGGTAAATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2404s21c1
Sequence:CCGGCCCTTATGTCTATGTGGAAATCTCGAGATTTCCACATAGACATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2010s21c1
Sequence:CCGGATGAAGTACTTGCGAGTAAATCTCGAGATTTACTCGCAAGTACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1716s1c1
Sequence:CCGGCCTCTCATCTTATGTTTAGAACTCGAGTTCTAAACATAAGATGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1410s1c1
Sequence:CCGGCCTGATTGTTACATCTTTGATCTCGAGATCAAAGATGTAACAATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-2516s1c1
Sequence:CCGGCCCTTATGTCTATGTGGAAATCTCGAGATTTCCACATAGACATAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013880.1-1055s1c1
Sequence:CCGGCCAGTGTATCAGAAACCTCAACTCGAGTTGAGGTTTCTGATACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013880.3-2686s21c1
Sequence:CCGGGTTCGTCCACGTGGCTATTACCTCGAGGTAATAGCCACGTGGACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015184
VALIDATED
PLCL2 MISSION shRNA Bacterial Glycerol Stock
phospholipase C-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015184.4-3696s21c1
Sequence:CCGGCATGCTTGCTGAGCCATAATTCTCGAGAATTATGGCTCAGCAAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-1071s21c1
Sequence:CCGGTCCATAGACGGGTTCACTAATCTCGAGATTAGTGAACCCGTCTATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-1357s21c1
Sequence:CCGGTCCGCAGTGTCATTGATATTACTCGAGTAATATCAATGACACTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-978s21c1
Sequence:CCGGGAACAGGGTGTGGCACATATACTCGAGTATATGTGCCACACCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-1277s1c1
Sequence:CCGGCGGAGTGTTGAATTAGATGTACTCGAGTACATCTAATTCAACACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-2492s21c1
Sequence:CCGGATTTGTCCACGTGGCTATTACCTCGAGGTAATAGCCACGTGGACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015184.x-3402s1c1
Sequence:CCGGACTGTGAATGTATGTAGCAATCTCGAGATTGCTACATACATTCACAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-3237s1c1
Sequence:CCGGCAAACGATGAAACTGGAGAATCTCGAGATTCTCCAGTTTCATCGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015184.x-846s1c1
Sequence:CCGGCCGAGGTCACAAAGGAAGAATCTCGAGATTCTTCCTTTGTGACCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-1501s1c1
Sequence:CCGGGCTCTATACAACATCACCCAACTCGAGTTGGGTGATGTTGTATAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015184
VALIDATED
PLCL2 MISSION shRNA shRNA Plasmid DNA
phospholipase C-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015184.4-3696s21c1
Sequence:CCGGCATGCTTGCTGAGCCATAATTCTCGAGAATTATGGCTCAGCAAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-1071s21c1
Sequence:CCGGTCCATAGACGGGTTCACTAATCTCGAGATTAGTGAACCCGTCTATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-1357s21c1
Sequence:CCGGTCCGCAGTGTCATTGATATTACTCGAGTAATATCAATGACACTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-978s21c1
Sequence:CCGGGAACAGGGTGTGGCACATATACTCGAGTATATGTGCCACACCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-1277s1c1
Sequence:CCGGCGGAGTGTTGAATTAGATGTACTCGAGTACATCTAATTCAACACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-2492s21c1
Sequence:CCGGATTTGTCCACGTGGCTATTACCTCGAGGTAATAGCCACGTGGACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015184.x-3402s1c1
Sequence:CCGGACTGTGAATGTATGTAGCAATCTCGAGATTGCTACATACATTCACAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-3237s1c1
Sequence:CCGGCAAACGATGAAACTGGAGAATCTCGAGATTCTCCAGTTTCATCGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015184.x-846s1c1
Sequence:CCGGCCGAGGTCACAAAGGAAGAATCTCGAGATTCTTCCTTTGTGACCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-1501s1c1
Sequence:CCGGGCTCTATACAACATCACCCAACTCGAGTTGGGTGATGTTGTATAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015184
VALIDATED
PLCL2 MISSION shRNA Lentiviral Transduction Particles
phospholipase C-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015184.4-3696s21c1
Sequence:CCGGCATGCTTGCTGAGCCATAATTCTCGAGAATTATGGCTCAGCAAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-1071s21c1
Sequence:CCGGTCCATAGACGGGTTCACTAATCTCGAGATTAGTGAACCCGTCTATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-1357s21c1
Sequence:CCGGTCCGCAGTGTCATTGATATTACTCGAGTAATATCAATGACACTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-978s21c1
Sequence:CCGGGAACAGGGTGTGGCACATATACTCGAGTATATGTGCCACACCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-1277s1c1
Sequence:CCGGCGGAGTGTTGAATTAGATGTACTCGAGTACATCTAATTCAACACTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015184.4-2492s21c1
Sequence:CCGGATTTGTCCACGTGGCTATTACCTCGAGGTAATAGCCACGTGGACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015184.x-3402s1c1
Sequence:CCGGACTGTGAATGTATGTAGCAATCTCGAGATTGCTACATACATTCACAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-3237s1c1
Sequence:CCGGCAAACGATGAAACTGGAGAATCTCGAGATTCTCCAGTTTCATCGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015184.x-846s1c1
Sequence:CCGGCCGAGGTCACAAAGGAAGAATCTCGAGATTCTTCCTTTGTGACCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015184.x-1501s1c1
Sequence:CCGGGCTCTATACAACATCACCCAACTCGAGTTGGGTGATGTTGTATAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)