EMAIL THIS PAGE TO A FRIEND

PLCXD1

phosphatidylinositol-specific phospholipase C, X domain containing 1

48 Gene Product Result for
UniProtKB ID: Q9NUJ7, A2BH51, A2BH52
Gene ID:
Human(55344) Summary: This gene is the most terminal protein-coding gene in the pseudoautosomal (PAR) region on chromosomes X and Y. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(403178) phosphatidylinositol-specific phospholipase C, X domain containing 1
Rat(304575) phosphatidylinositol-specific phospholipase C, X domain containing 1
chicken(418673) phosphatidylinositol-specific phospholipase C, X domain containing 1
dog(608690) phosphatidylinositol-specific phospholipase C, X domain containing 1
domestic cat(101099434) phosphatidylinositol-specific phospholipase C, X domain containing 1
naked mole-rat(101700896) phosphatidylinositol-specific phospholipase C, X domain containing 1
cow(614318) PI-PLC X domain-containing protein 1-like
cow(784663) phosphatidylinositol-specific phospholipase C, X domain containing 1
sheep(101116550) phosphatidylinositol-specific phospholipase C, X domain containing 1
cow(783100) phosphatidylinositol-specific phospholipase C, X domain containing 1
cow(100125761) phosphatidylinositol-specific phospholipase C, X domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018390 Rosetta Predictions human pricing
XM_001080726 Rosetta Predictions rat pricing
XM_222258 Rosetta Predictions rat pricing
NM_207279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170829 predicted 1030
2 SASI_Hs01_00170831 predicted 560
3 SASI_Hs01_00170832 predicted 355
4 SASI_Hs01_00170833 predicted 1057
5 SASI_Hs01_00170834 predicted 1038
6 SASI_Hs01_00170835 predicted 778
7 SASI_Hs01_00170836 predicted 529
8 SASI_Hs02_00351882 predicted 301
9 SASI_Hs01_00170837 predicted 307
10 SASI_Hs01_00170838 predicted 635
11 SASI_Hs01_00170830 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369090 predicted 1028
2 SASI_Rn02_00369091 predicted 1093
3 SASI_Rn02_00369092 predicted 1081
4 SASI_Rn02_00369093 predicted 689
5 SASI_Rn02_00369094 predicted 1089
6 SASI_Rn02_00369095 predicted 1082
7 SASI_Rn02_00369096 predicted 586
8 SASI_Rn02_00369097 predicted 695
9 SASI_Rn02_00369098 predicted 1017
10 SASI_Rn02_00369099 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380695 predicted 1025
2 SASI_Rn02_00380696 predicted 1097
3 SASI_Rn02_00380697 predicted 1086
4 SASI_Rn02_00380698 predicted 690
5 SASI_Rn02_00380699 predicted 1081
6 SASI_Rn02_00380700 predicted 1082
7 SASI_Rn02_00380701 predicted 583
8 SASI_Rn02_00380702 predicted 702
9 SASI_Rn02_00380703 predicted 1024
10 SASI_Rn02_00380704 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352041 predicted 921
2 SASI_Mm01_00108090 predicted 520
3 SASI_Mm01_00108091 predicted 1070
4 SASI_Mm01_00108092 predicted 545
5 SASI_Mm01_00108093 predicted 913
6 SASI_Mm01_00108094 predicted 1092
7 SASI_Mm01_00108095 predicted 333
8 SASI_Mm01_00108096 predicted 662
9 SASI_Mm01_00108097 predicted 771
10 SASI_Mm01_00108098 predicted 596
11 SASI_Mm01_00108099 predicted 1120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018390
VALIDATED
PLCXD1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-specific phospholipase C, X domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-436s21c1
Sequence:CCGGGATGACGTACTGCCTGAACAACTCGAGTTGTTCAGGCAGTACGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-883s1c1
Sequence:CCGGCAACAGGTCATCGTCTCCTATCTCGAGATAGGAGACGATGACCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018390.1-1315s1c1
Sequence:CCGGCCGAATTTCCAAATGGAGTTTCTCGAGAAACTCCATTTGGAAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-438s1c1
Sequence:CCGGGATGACGTACTGCCTGAACAACTCGAGTTGTTCAGGCAGTACGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-801s1c1
Sequence:CCGGCGCCTGTATCAAGAACATCTTCTCGAGAAGATGTTCTTGATACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-1218s1c1
Sequence:CCGGCGGCTTCGTCAGTGACGTCATCTCGAGATGACGTCACTGACGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-1746s21c1
Sequence:CCGGGATGATCCTCAAGAACGTTATCTCGAGATAACGTTCTTGAGGATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-685s21c1
Sequence:CCGGGGAGGACACACTCACGGAAATCTCGAGATTTCCGTGAGTGTGTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-643s21c1
Sequence:CCGGGAACCTGCACTTTGTCCATATCTCGAGATATGGACAAAGTGCAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-799s21c1
Sequence:CCGGCGCCTGTATCAAGAACATCTTCTCGAGAAGATGTTCTTGATACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018390
VALIDATED
PLCXD1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-specific phospholipase C, X domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-436s21c1
Sequence:CCGGGATGACGTACTGCCTGAACAACTCGAGTTGTTCAGGCAGTACGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-883s1c1
Sequence:CCGGCAACAGGTCATCGTCTCCTATCTCGAGATAGGAGACGATGACCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018390.1-1315s1c1
Sequence:CCGGCCGAATTTCCAAATGGAGTTTCTCGAGAAACTCCATTTGGAAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-438s1c1
Sequence:CCGGGATGACGTACTGCCTGAACAACTCGAGTTGTTCAGGCAGTACGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-801s1c1
Sequence:CCGGCGCCTGTATCAAGAACATCTTCTCGAGAAGATGTTCTTGATACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-1218s1c1
Sequence:CCGGCGGCTTCGTCAGTGACGTCATCTCGAGATGACGTCACTGACGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-1746s21c1
Sequence:CCGGGATGATCCTCAAGAACGTTATCTCGAGATAACGTTCTTGAGGATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-685s21c1
Sequence:CCGGGGAGGACACACTCACGGAAATCTCGAGATTTCCGTGAGTGTGTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-643s21c1
Sequence:CCGGGAACCTGCACTTTGTCCATATCTCGAGATATGGACAAAGTGCAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-799s21c1
Sequence:CCGGCGCCTGTATCAAGAACATCTTCTCGAGAAGATGTTCTTGATACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018390
VALIDATED
PLCXD1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-specific phospholipase C, X domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-436s21c1
Sequence:CCGGGATGACGTACTGCCTGAACAACTCGAGTTGTTCAGGCAGTACGTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000078244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-883s1c1
Sequence:CCGGCAACAGGTCATCGTCTCCTATCTCGAGATAGGAGACGATGACCTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000078243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018390.1-1315s1c1
Sequence:CCGGCCGAATTTCCAAATGGAGTTTCTCGAGAAACTCCATTTGGAAATTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000078245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-438s1c1
Sequence:CCGGGATGACGTACTGCCTGAACAACTCGAGTTGTTCAGGCAGTACGTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000078246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-801s1c1
Sequence:CCGGCGCCTGTATCAAGAACATCTTCTCGAGAAGATGTTCTTGATACAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000078247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018390.1-1218s1c1
Sequence:CCGGCGGCTTCGTCAGTGACGTCATCTCGAGATGACGTCACTGACGAAGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-1746s21c1
Sequence:CCGGGATGATCCTCAAGAACGTTATCTCGAGATAACGTTCTTGAGGATCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-685s21c1
Sequence:CCGGGGAGGACACACTCACGGAAATCTCGAGATTTCCGTGAGTGTGTCCTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-643s21c1
Sequence:CCGGGAACCTGCACTTTGTCCATATCTCGAGATATGGACAAAGTGCAGGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018390.2-799s21c1
Sequence:CCGGCGCCTGTATCAAGAACATCTTCTCGAGAAGATGTTCTTGATACAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207279
PLCXD1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-specific phospholipase C, X domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207279.1-1188s21c1
Sequence:CCGGTCACCACTTCGGAGACCTTCACTCGAGTGAAGGTCTCCGAAGTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-1122s1c1
Sequence:CCGGGAGTAAGGTCATCAGCCTGAACTCGAGTTCAGGCTGATGACCTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-954s1c1
Sequence:CCGGCACTGAGAACCTGTGCTACATCTCGAGATGTAGCACAGGTTCTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-945s1c1
Sequence:CCGGGATCAACATCACTGAGAACCTCTCGAGAGGTTCTCAGTGATGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-671s21c1
Sequence:CCGGCTTGTGAGTTGCACGACTATCCTCGAGGATAGTCGTGCAACTCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-1106s21c1
Sequence:CCGGATGCGGATGGCTTCGTGAGTACTCGAGTACTCACGAAGCCATCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-933s21c1
Sequence:CCGGGTTCGTTGCTGGGATCAACATCTCGAGATGTTGATCCCAGCAACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-322s21c1
Sequence:CCGGAGCCACGACACGATGACATACCTCGAGGTATGTCATCGTGTCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207279
PLCXD1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-specific phospholipase C, X domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207279.1-1188s21c1
Sequence:CCGGTCACCACTTCGGAGACCTTCACTCGAGTGAAGGTCTCCGAAGTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-1122s1c1
Sequence:CCGGGAGTAAGGTCATCAGCCTGAACTCGAGTTCAGGCTGATGACCTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-954s1c1
Sequence:CCGGCACTGAGAACCTGTGCTACATCTCGAGATGTAGCACAGGTTCTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-945s1c1
Sequence:CCGGGATCAACATCACTGAGAACCTCTCGAGAGGTTCTCAGTGATGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-671s21c1
Sequence:CCGGCTTGTGAGTTGCACGACTATCCTCGAGGATAGTCGTGCAACTCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-1106s21c1
Sequence:CCGGATGCGGATGGCTTCGTGAGTACTCGAGTACTCACGAAGCCATCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-933s21c1
Sequence:CCGGGTTCGTTGCTGGGATCAACATCTCGAGATGTTGATCCCAGCAACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-322s21c1
Sequence:CCGGAGCCACGACACGATGACATACCTCGAGGTATGTCATCGTGTCGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207279
PLCXD1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-specific phospholipase C, X domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207279.1-1188s21c1
Sequence:CCGGTCACCACTTCGGAGACCTTCACTCGAGTGAAGGTCTCCGAAGTGGTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000189966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-1122s1c1
Sequence:CCGGGAGTAAGGTCATCAGCCTGAACTCGAGTTCAGGCTGATGACCTTACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-954s1c1
Sequence:CCGGCACTGAGAACCTGTGCTACATCTCGAGATGTAGCACAGGTTCTCAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207279.1-945s1c1
Sequence:CCGGGATCAACATCACTGAGAACCTCTCGAGAGGTTCTCAGTGATGTTGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-671s21c1
Sequence:CCGGCTTGTGAGTTGCACGACTATCCTCGAGGATAGTCGTGCAACTCACAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-1106s21c1
Sequence:CCGGATGCGGATGGCTTCGTGAGTACTCGAGTACTCACGAAGCCATCCGCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-933s21c1
Sequence:CCGGGTTCGTTGCTGGGATCAACATCTCGAGATGTTGATCCCAGCAACGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207279.1-322s21c1
Sequence:CCGGAGCCACGACACGATGACATACCTCGAGGTATGTCATCGTGTCGTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???