EMAIL THIS PAGE TO A FRIEND

PLCXD3

phosphatidylinositol-specific phospholipase C, X domain containing 3

280 Gene Product Result for
UniProtKB ID: Q63HM9, A6NL04
Gene ID:
Mouse(239318) phosphatidylinositol-specific phospholipase C, X domain containing 3
Rat(310358) phosphatidylinositol-specific phospholipase C, X domain containing 3
Zebrafish(541487) phosphatidylinositol-specific phospholipase C, X domain containing 3
Horse(100053067) phosphatidylinositol-specific phospholipase C, X domain containing 3
domestic cat(101094651) phosphatidylinositol-specific phospholipase C, X domain containing 3
dog(612494) phosphatidylinositol-specific phospholipase C, X domain containing 3
naked mole-rat(101719592) phosphatidylinositol-specific phospholipase C, X domain containing 3
domestic guinea pig(100733695) phosphatidylinositol-specific phospholipase C, X domain containing 3
cow(781239) phosphatidylinositol-specific phospholipase C, X domain containing 3
sheep(101102423) phosphatidylinositol-specific phospholipase C, X domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_293875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005473 Rosetta Predictions human pricing
NM_001107671 Rosetta Predictions rat pricing
NM_177355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212790 predicted 1002
2 SASI_Hs01_00212791 predicted 477
3 SASI_Hs01_00212793 predicted 260
4 SASI_Hs02_00304937 predicted 583
5 SASI_Hs01_00212795 predicted 1018
6 SASI_Hs01_00212798 predicted 575
7 SASI_Hs01_00212799 predicted 476
8 SASI_Hs02_00304938 predicted 456
9 SASI_Hs02_00304939 predicted 770
10 SASI_Hs02_00304940 predicted 728
11 SASI_Hs01_00212792 predicted 553
12 SASI_Hs01_00212794 predicted 211
13 SASI_Hs01_00212796 predicted 269
14 SASI_Hs01_00212797 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231125 predicted 783
2 SASI_Rn02_00231126 predicted 434
3 SASI_Rn02_00231127 predicted 593
4 SASI_Rn02_00231128 predicted 1229
5 SASI_Rn02_00231129 predicted 843
6 SASI_Rn02_00231130 predicted 1277
7 SASI_Rn02_00231131 predicted 498
8 SASI_Rn02_00231132 predicted 649
9 SASI_Rn02_00231133 predicted 455
10 SASI_Rn02_00231134 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347497 predicted 1118
2 SASI_Mm02_00347498 predicted 1233
3 SASI_Mm01_00178140 predicted 879
4 SASI_Mm02_00347499 predicted 1214
5 SASI_Mm01_00178142 predicted 722
6 SASI_Mm01_00178143 predicted 492
7 SASI_Mm01_00178145 predicted 635
8 SASI_Mm01_00178147 predicted 919
9 SASI_Mm02_00347500 predicted 1179
10 SASI_Mm02_00347501 predicted 754
11 SASI_Mm01_00178139 predicted 1413
12 SASI_Mm01_00178141 predicted 1159
13 SASI_Mm01_00178144 predicted 1218
14 SASI_Mm01_00178146 predicted 1263
15 SASI_Mm01_00178148 predicted 1325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293875
PLCXD3 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-specific phospholipase C, X domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-739s1c1
Sequence:CCGGCCCGAGAAACTGATCCAGTTTCTCGAGAAACTGGATCAGTTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_293875.4-1811s1c1
Sequence:CCGGCCCTGCAAGTACCCAGTAAATCTCGAGATTTACTGGGTACTTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-237s1c1
Sequence:CCGGGCCAGAAACTGTCCAGAATTTCTCGAGAAATTCTGGACAGTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-463s1c1
Sequence:CCGGGCATTCCTCACAGATCACCATCTCGAGATGGTGATCTGTGAGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-558s1c1
Sequence:CCGGGCTGAAAGACATCTATGGAAACTCGAGTTTCCATAGATGTCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293875
PLCXD3 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-specific phospholipase C, X domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-739s1c1
Sequence:CCGGCCCGAGAAACTGATCCAGTTTCTCGAGAAACTGGATCAGTTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_293875.4-1811s1c1
Sequence:CCGGCCCTGCAAGTACCCAGTAAATCTCGAGATTTACTGGGTACTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-237s1c1
Sequence:CCGGGCCAGAAACTGTCCAGAATTTCTCGAGAAATTCTGGACAGTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-463s1c1
Sequence:CCGGGCATTCCTCACAGATCACCATCTCGAGATGGTGATCTGTGAGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-558s1c1
Sequence:CCGGGCTGAAAGACATCTATGGAAACTCGAGTTTCCATAGATGTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293875
PLCXD3 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-specific phospholipase C, X domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-739s1c1
Sequence:CCGGCCCGAGAAACTGATCCAGTTTCTCGAGAAACTGGATCAGTTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_293875.4-1811s1c1
Sequence:CCGGCCCTGCAAGTACCCAGTAAATCTCGAGATTTACTGGGTACTTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-237s1c1
Sequence:CCGGGCCAGAAACTGTCCAGAATTTCTCGAGAAATTCTGGACAGTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-463s1c1
Sequence:CCGGGCATTCCTCACAGATCACCATCTCGAGATGGTGATCTGTGAGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293875.4-558s1c1
Sequence:CCGGGCTGAAAGACATCTATGGAAACTCGAGTTTCCATAGATGTCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177355
PLCXD3 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-specific phospholipase C, X domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-747s21c1
Sequence:CCGGTGCCCAGGAAGTGAGTCTAAACTCGAGTTTAGACTCACTTCCTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177355.2-980s1c1
Sequence:CCGGGAGAAATTGATCCAGTTTCTTCTCGAGAAGAAACTGGATCAATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-500s21c1
Sequence:CCGGGTTACTTCGACCTTCGAATTTCTCGAGAAATTCGAAGGTCGAAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177355.2-3375s1c1
Sequence:CCGGCGCTGATACTAATTGATCTATCTCGAGATAGATCAATTAGTATCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-1076s21c1
Sequence:CCGGCAGGAGAGAGCGGCATCAATACTCGAGTATTGATGCCGCTCTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-429s21c1
Sequence:CCGGCAAGAAGTTGATGCGGAAATGCTCGAGCATTTCCGCATCAACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177355.3-1602s21c1
Sequence:CCGGACAATTGAATGCCCGACATAACTCGAGTTATGTCGGGCATTCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177355.2-1095s1c1
Sequence:CCGGCAAGTGGACTCAGAGAAACAACTCGAGTTGTTTCTCTGAGTCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177355
PLCXD3 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-specific phospholipase C, X domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-747s21c1
Sequence:CCGGTGCCCAGGAAGTGAGTCTAAACTCGAGTTTAGACTCACTTCCTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177355.2-980s1c1
Sequence:CCGGGAGAAATTGATCCAGTTTCTTCTCGAGAAGAAACTGGATCAATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-500s21c1
Sequence:CCGGGTTACTTCGACCTTCGAATTTCTCGAGAAATTCGAAGGTCGAAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177355.2-3375s1c1
Sequence:CCGGCGCTGATACTAATTGATCTATCTCGAGATAGATCAATTAGTATCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-1076s21c1
Sequence:CCGGCAGGAGAGAGCGGCATCAATACTCGAGTATTGATGCCGCTCTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-429s21c1
Sequence:CCGGCAAGAAGTTGATGCGGAAATGCTCGAGCATTTCCGCATCAACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177355.3-1602s21c1
Sequence:CCGGACAATTGAATGCCCGACATAACTCGAGTTATGTCGGGCATTCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177355.2-1095s1c1
Sequence:CCGGCAAGTGGACTCAGAGAAACAACTCGAGTTGTTTCTCTGAGTCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177355
PLCXD3 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-specific phospholipase C, X domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-747s21c1
Sequence:CCGGTGCCCAGGAAGTGAGTCTAAACTCGAGTTTAGACTCACTTCCTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177355.2-980s1c1
Sequence:CCGGGAGAAATTGATCCAGTTTCTTCTCGAGAAGAAACTGGATCAATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-500s21c1
Sequence:CCGGGTTACTTCGACCTTCGAATTTCTCGAGAAATTCGAAGGTCGAAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177355.2-3375s1c1
Sequence:CCGGCGCTGATACTAATTGATCTATCTCGAGATAGATCAATTAGTATCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-1076s21c1
Sequence:CCGGCAGGAGAGAGCGGCATCAATACTCGAGTATTGATGCCGCTCTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177355.3-429s21c1
Sequence:CCGGCAAGAAGTTGATGCGGAAATGCTCGAGCATTTCCGCATCAACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177355.3-1602s21c1
Sequence:CCGGACAATTGAATGCCCGACATAACTCGAGTTATGTCGGGCATTCAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177355.2-1095s1c1
Sequence:CCGGCAAGTGGACTCAGAGAAACAACTCGAGTTGTTTCTCTGAGTCCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)