EMAIL THIS PAGE TO A FRIEND

PLD4

phospholipase D family, member 4

51 Gene Product Result for
Synonyms: C14orf175
UniProtKB ID: Q96BZ4, Q6UWD2
Gene ID:
Mouse(104759) phospholipase D family, member 4
Rat(362792) phospholipase D family, member 4
chicken(423496) phospholipase D family, member 4
domestic cat(101088418) phospholipase D family, member 4
Horse(100146639) phospholipase D family, member 4
dog(612697) phospholipase D family, member 4
cow(789315) phospholipase D family, member 4
sheep(101104691) phospholipase D family, member 4
domestic guinea pig(100725266) phospholipase D family, member 4
naked mole-rat(101698668) phospholipase D family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
D1262 P1,P4-Di(adenosine-5′) tetraphosphate ammonium salt ≥95% (HPLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138790 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138790 Rosetta Predictions human pricing
NM_001126288 Rosetta Predictions rat pricing
NM_178911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157711 predicted 859
2 SASI_Hs01_00157712 predicted 1460
3 SASI_Hs01_00157713 predicted 871
4 SASI_Hs01_00157714 predicted 1426
5 SASI_Hs01_00157717 predicted 1419
6 SASI_Hs01_00157718 predicted 1448
7 SASI_Hs01_00157719 predicted 1457
8 SASI_Hs01_00157720 predicted 795
9 SASI_Hs02_00363932 predicted 1003
10 SASI_Hs02_00363933 predicted 908
11 SASI_Hs01_00157715 predicted 1354
12 SASI_Hs01_00157716 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253253 predicted 1591
2 SASI_Rn02_00253254 predicted 1322
3 SASI_Rn02_00253255 predicted 1411
4 SASI_Rn02_00253256 predicted 1401
5 SASI_Rn02_00253257 predicted 1292
6 SASI_Rn02_00253258 predicted 820
7 SASI_Rn02_00253259 predicted 706
8 SASI_Rn02_00253260 predicted 1412
9 SASI_Rn02_00253261 predicted 1612
10 SASI_Rn02_00253262 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349526 predicted 1417
2 SASI_Mm01_00109286 predicted 493
3 SASI_Mm01_00109287 predicted 822
4 SASI_Mm01_00109288 predicted 1668
5 SASI_Mm01_00109289 predicted 1406
6 SASI_Mm01_00109290 predicted 813
7 SASI_Mm01_00109291 predicted 221
8 SASI_Mm01_00109292 predicted 681
9 SASI_Mm01_00109293 predicted 723
10 SASI_Mm01_00109294 predicted 1620
11 SASI_Mm01_00109295 predicted 1573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178911
PLD4 MISSION shRNA Bacterial Glycerol Stock
phospholipase D family, member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-1547s21c1
Sequence:CCGGGAGACTGGAGTTCCCACTATGCTCGAGCATAGTGGGAACTCCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-1105s21c1
Sequence:CCGGGTCTCGGTGATGGAGTATTTCCTCGAGGAAATACTCCATCACCGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178911.4-1733s1c1
Sequence:CCGGCGAGATTGTCATCAGACAAACCTCGAGGTTTGTCTGATGACAATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-726s21c1
Sequence:CCGGGGGTGTTCTACACTCCAAATTCTCGAGAATTTGGAGTGTAGAACACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-695s21c1
Sequence:CCGGTACGACAAGTGCCCATGAAACCTCGAGGTTTCATGGGCACTTGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178911.4-1617s21c1
Sequence:CCGGCTGAGGGTTGATCCCTTTGATCTCGAGATCAAAGGGATCAACCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-735s1c1
Sequence:CCGGCTACACTCCAAATTCTGGGTTCTCGAGAACCCAGAATTTGGAGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-383s1c1
Sequence:CCGGGCTCATCCTTGTGGAAAGCATCTCGAGATGCTTTCCACAAGGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-1569s1c1
Sequence:CCGGGCTATGGACCTAGACAGACAACTCGAGTTGTCTGTCTAGGTCCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178911
PLD4 MISSION shRNA shRNA Plasmid DNA
phospholipase D family, member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-1547s21c1
Sequence:CCGGGAGACTGGAGTTCCCACTATGCTCGAGCATAGTGGGAACTCCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-1105s21c1
Sequence:CCGGGTCTCGGTGATGGAGTATTTCCTCGAGGAAATACTCCATCACCGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178911.4-1733s1c1
Sequence:CCGGCGAGATTGTCATCAGACAAACCTCGAGGTTTGTCTGATGACAATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-726s21c1
Sequence:CCGGGGGTGTTCTACACTCCAAATTCTCGAGAATTTGGAGTGTAGAACACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-695s21c1
Sequence:CCGGTACGACAAGTGCCCATGAAACCTCGAGGTTTCATGGGCACTTGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178911.4-1617s21c1
Sequence:CCGGCTGAGGGTTGATCCCTTTGATCTCGAGATCAAAGGGATCAACCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-735s1c1
Sequence:CCGGCTACACTCCAAATTCTGGGTTCTCGAGAACCCAGAATTTGGAGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-383s1c1
Sequence:CCGGGCTCATCCTTGTGGAAAGCATCTCGAGATGCTTTCCACAAGGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-1569s1c1
Sequence:CCGGGCTATGGACCTAGACAGACAACTCGAGTTGTCTGTCTAGGTCCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178911
PLD4 MISSION shRNA Lentiviral Transduction Particles
phospholipase D family, member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-1547s21c1
Sequence:CCGGGAGACTGGAGTTCCCACTATGCTCGAGCATAGTGGGAACTCCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-1105s21c1
Sequence:CCGGGTCTCGGTGATGGAGTATTTCCTCGAGGAAATACTCCATCACCGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178911.4-1733s1c1
Sequence:CCGGCGAGATTGTCATCAGACAAACCTCGAGGTTTGTCTGATGACAATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-726s21c1
Sequence:CCGGGGGTGTTCTACACTCCAAATTCTCGAGAATTTGGAGTGTAGAACACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178911.4-695s21c1
Sequence:CCGGTACGACAAGTGCCCATGAAACCTCGAGGTTTCATGGGCACTTGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178911.4-1617s21c1
Sequence:CCGGCTGAGGGTTGATCCCTTTGATCTCGAGATCAAAGGGATCAACCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-735s1c1
Sequence:CCGGCTACACTCCAAATTCTGGGTTCTCGAGAACCCAGAATTTGGAGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-383s1c1
Sequence:CCGGGCTCATCCTTGTGGAAAGCATCTCGAGATGCTTTCCACAAGGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178911.2-1569s1c1
Sequence:CCGGGCTATGGACCTAGACAGACAACTCGAGTTGTCTGTCTAGGTCCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138790
PLD4 MISSION shRNA Bacterial Glycerol Stock
phospholipase D family, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-950s1c1
Sequence:CCGGCTCATCTCACTTCAACCGTTTCTCGAGAAACGGTTGAAGTGAGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-389s1c1
Sequence:CCGGGCTTGTCCTTGTGGAAAGCATCTCGAGATGCTTTCCACAAGGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-1112s1c1
Sequence:CCGGTGCCTCCGTGATGGAGTATTTCTCGAGAAATACTCCATCACGGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-1391s1c1
Sequence:CCGGCAAGTTCATGGTCACGGAGAACTCGAGTTCTCCGTGACCATGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-806s1c1
Sequence:CCGGGCGGTCTCTGACGCAGGTGAACTCGAGTTCACCTGCGTCAGAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138790
PLD4 MISSION shRNA shRNA Plasmid DNA
phospholipase D family, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-950s1c1
Sequence:CCGGCTCATCTCACTTCAACCGTTTCTCGAGAAACGGTTGAAGTGAGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-389s1c1
Sequence:CCGGGCTTGTCCTTGTGGAAAGCATCTCGAGATGCTTTCCACAAGGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-1112s1c1
Sequence:CCGGTGCCTCCGTGATGGAGTATTTCTCGAGAAATACTCCATCACGGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-1391s1c1
Sequence:CCGGCAAGTTCATGGTCACGGAGAACTCGAGTTCTCCGTGACCATGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-806s1c1
Sequence:CCGGGCGGTCTCTGACGCAGGTGAACTCGAGTTCACCTGCGTCAGAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138790
PLD4 MISSION shRNA Lentiviral Transduction Particles
phospholipase D family, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-950s1c1
Sequence:CCGGCTCATCTCACTTCAACCGTTTCTCGAGAAACGGTTGAAGTGAGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-389s1c1
Sequence:CCGGGCTTGTCCTTGTGGAAAGCATCTCGAGATGCTTTCCACAAGGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-1112s1c1
Sequence:CCGGTGCCTCCGTGATGGAGTATTTCTCGAGAAATACTCCATCACGGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-1391s1c1
Sequence:CCGGCAAGTTCATGGTCACGGAGAACTCGAGTTCTCCGTGACCATGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138790.1-806s1c1
Sequence:CCGGGCGGTCTCTGACGCAGGTGAACTCGAGTTCACCTGCGTCAGAGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)