EMAIL THIS PAGE TO A FRIEND

PLD6

phospholipase D family, member 6

62 Gene Product Result for
Synonyms: ZUC
UniProtKB ID: Q8N2A8, Q8N5Y1
Gene ID:
Mouse(194908) phospholipase D family, member 6
Rat(287366) phospholipase D family, member 6
Zebrafish(567338) phospholipase D family, member 6
domestic cat(101088529) phospholipase D family, member 6
dog(489545) phospholipase D family, member 6
cow(526651) phospholipase D family, member 6
sheep(101113688) phospholipase D family, member 6
domestic guinea pig(100726923) phospholipase D family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040081 MISSION® esiRNA esiRNA human PLD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178836 Rosetta Predictions human pricing
XM_001077240 Rosetta Predictions rat pricing
XM_220517 Rosetta Predictions rat pricing
NM_183139 Rosetta Predictions mouse pricing
XM_110919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132879 predicted 1080
2 SASI_Hs01_00132880 predicted 876
3 SASI_Hs01_00132881 predicted 480
4 SASI_Hs01_00132883 predicted 936
5 SASI_Hs01_00132884 predicted 931
6 SASI_Hs01_00132885 predicted 634
7 SASI_Hs01_00132886 predicted 527
8 SASI_Hs01_00132887 predicted 879
9 SASI_Hs01_00132888 predicted 654
10 SASI_Hs02_00369887 predicted 741
11 SASI_Hs01_00132882 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356313 predicted 406
2 SASI_Rn02_00356314 predicted 360
3 SASI_Rn02_00356315 predicted 390
4 SASI_Rn02_00356316 predicted 410
5 SASI_Rn02_00356317 predicted 453
6 SASI_Rn02_00356318 predicted 457
7 SASI_Rn02_00356319 predicted 318
8 SASI_Rn02_00356320 predicted 375
9 SASI_Rn02_00356321 predicted 202
10 SASI_Rn02_00356322 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379341 predicted 409
2 SASI_Rn02_00379342 predicted 351
3 SASI_Rn02_00379343 predicted 383
4 SASI_Rn02_00379344 predicted 412
5 SASI_Rn02_00379345 predicted 456
6 SASI_Rn02_00379346 predicted 452
7 SASI_Rn02_00379347 predicted 324
8 SASI_Rn02_00379348 predicted 372
9 SASI_Rn02_00379349 predicted 208
10 SASI_Rn02_00379350 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350152 predicted 583
2 SASI_Mm02_00350153 predicted 474
3 SASI_Mm02_00350154 predicted 844
4 SASI_Mm02_00350155 predicted 809
5 SASI_Mm02_00350156 predicted 460
6 SASI_Mm02_00350157 predicted 388
7 SASI_Mm02_00350158 predicted 897
8 SASI_Mm02_00350159 predicted 532
9 SASI_Mm02_00350160 predicted 606
10 SASI_Mm02_00350161 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269728 predicted 865
2 SASI_Mm01_00269729 predicted 844
3 SASI_Mm01_00269730 predicted 817
4 SASI_Mm01_00269731 predicted 974
5 SASI_Mm01_00269732 predicted 1088
6 SASI_Mm01_00269733 predicted 912
7 SASI_Mm01_00269734 predicted 1006
8 SASI_Mm01_00269735 predicted 827
9 SASI_Mm01_00269736 predicted 901
10 SASI_Mm01_00269737 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178836
PLD6 MISSION shRNA Bacterial Glycerol Stock
phospholipase D family, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178836.3-665s21c1
Sequence:CCGGGAACAGTTTAACCCTACAAAGCTCGAGCTTTGTAGGGTTAAACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-515s1c1
Sequence:CCGGCGTGGACAAGAGGGTGCTCATCTCGAGATGAGCACCCTCTTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-575s1c1
Sequence:CCGGCAACAGGGAGAATGTTCTCATCTCGAGATGAGAACATTCTCCCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-626s1c1
Sequence:CCGGTCTGGAAGAATTTGAGCGCATCTCGAGATGCGCTCAAATTCTTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-730s1c1
Sequence:CCGGCTGGAGGGAGATTGCTTTCATCTCGAGATGAAAGCAATCTCCCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178836.3-499s21c1
Sequence:CCGGCCCAGGCTACATGCATCACAACTCGAGTTGTGATGCATGTAGCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178836.3-1037s21c1
Sequence:CCGGTTCATGAGTGTGGTCCGTATCCTCGAGGATACGGACCACACTCATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-398s1c1
Sequence:CCGGCGTCACCGACTGCGACTACATCTCGAGATGTAGTCGCAGTCGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178836
PLD6 MISSION shRNA shRNA Plasmid DNA
phospholipase D family, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178836.3-665s21c1
Sequence:CCGGGAACAGTTTAACCCTACAAAGCTCGAGCTTTGTAGGGTTAAACTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-515s1c1
Sequence:CCGGCGTGGACAAGAGGGTGCTCATCTCGAGATGAGCACCCTCTTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-575s1c1
Sequence:CCGGCAACAGGGAGAATGTTCTCATCTCGAGATGAGAACATTCTCCCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-626s1c1
Sequence:CCGGTCTGGAAGAATTTGAGCGCATCTCGAGATGCGCTCAAATTCTTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-730s1c1
Sequence:CCGGCTGGAGGGAGATTGCTTTCATCTCGAGATGAAAGCAATCTCCCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178836.3-499s21c1
Sequence:CCGGCCCAGGCTACATGCATCACAACTCGAGTTGTGATGCATGTAGCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178836.3-1037s21c1
Sequence:CCGGTTCATGAGTGTGGTCCGTATCCTCGAGGATACGGACCACACTCATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-398s1c1
Sequence:CCGGCGTCACCGACTGCGACTACATCTCGAGATGTAGTCGCAGTCGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178836
PLD6 MISSION shRNA Lentiviral Transduction Particles
phospholipase D family, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178836.3-665s21c1
Sequence:CCGGGAACAGTTTAACCCTACAAAGCTCGAGCTTTGTAGGGTTAAACTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-515s1c1
Sequence:CCGGCGTGGACAAGAGGGTGCTCATCTCGAGATGAGCACCCTCTTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-575s1c1
Sequence:CCGGCAACAGGGAGAATGTTCTCATCTCGAGATGAGAACATTCTCCCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-626s1c1
Sequence:CCGGTCTGGAAGAATTTGAGCGCATCTCGAGATGCGCTCAAATTCTTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-730s1c1
Sequence:CCGGCTGGAGGGAGATTGCTTTCATCTCGAGATGAAAGCAATCTCCCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178836.3-499s21c1
Sequence:CCGGCCCAGGCTACATGCATCACAACTCGAGTTGTGATGCATGTAGCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178836.3-1037s21c1
Sequence:CCGGTTCATGAGTGTGGTCCGTATCCTCGAGGATACGGACCACACTCATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178836.2-398s1c1
Sequence:CCGGCGTCACCGACTGCGACTACATCTCGAGATGTAGTCGCAGTCGGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183139
PLD6 MISSION shRNA Bacterial Glycerol Stock
phospholipase D family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-163s21c1
Sequence:CCGGGACCTGCACCGAGGCTTTACTCTCGAGAGTAAAGCCTCGGTGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-462s21c1
Sequence:CCGGCCTAGGCTACATGCACCACAACTCGAGTTGTGGTGCATGTAGCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183139.2-1230s21c1
Sequence:CCGGATGCTTGTGTGCACGACAAACCTCGAGGTTTGTCGTGCACACAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-378s21c1
Sequence:CCGGTCATCACTGACTGCGACTACACTCGAGTGTAGTCGCAGTCAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-297s21c1
Sequence:CCGGAGCTCTGCCTCTTCGCCTTCTCTCGAGAGAAGGCGAAGAGGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183139
PLD6 MISSION shRNA shRNA Plasmid DNA
phospholipase D family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-163s21c1
Sequence:CCGGGACCTGCACCGAGGCTTTACTCTCGAGAGTAAAGCCTCGGTGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-462s21c1
Sequence:CCGGCCTAGGCTACATGCACCACAACTCGAGTTGTGGTGCATGTAGCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183139.2-1230s21c1
Sequence:CCGGATGCTTGTGTGCACGACAAACCTCGAGGTTTGTCGTGCACACAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-378s21c1
Sequence:CCGGTCATCACTGACTGCGACTACACTCGAGTGTAGTCGCAGTCAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-297s21c1
Sequence:CCGGAGCTCTGCCTCTTCGCCTTCTCTCGAGAGAAGGCGAAGAGGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183139
PLD6 MISSION shRNA Lentiviral Transduction Particles
phospholipase D family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-163s21c1
Sequence:CCGGGACCTGCACCGAGGCTTTACTCTCGAGAGTAAAGCCTCGGTGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-462s21c1
Sequence:CCGGCCTAGGCTACATGCACCACAACTCGAGTTGTGGTGCATGTAGCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183139.2-1230s21c1
Sequence:CCGGATGCTTGTGTGCACGACAAACCTCGAGGTTTGTCGTGCACACAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-378s21c1
Sequence:CCGGTCATCACTGACTGCGACTACACTCGAGTGTAGTCGCAGTCAGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183139.2-297s21c1
Sequence:CCGGAGCTCTGCCTCTTCGCCTTCTCTCGAGAGAAGGCGAAGAGGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)