EMAIL THIS PAGE TO A FRIEND

PLEC

plectin

272 Gene Product Result for
Synonyms: EBS1 EBSO HD1 LGMD2Q PCN PLEC1 PLEC1b PLTN
Gene ID:
Human(5339) Summary: Plectin is a prominent member of an important family of structurally and in part functionally related proteins, termed plakins or cytolinkers, that are capable of interlinking different elements of the cytoskeleton. Plakins, with their multi-domain structure and enormous size, not only play crucial roles in maintaining cell and tissue integrity and orchestrating dynamic changes in cytoarchitecture and cell shape, but also serve as scaffolding platforms for the assembly, positioning, and regulation of signaling complexes (reviewed in PMID: 9701547, 11854008, and 17499243). Plectin is expressed as several protein isoforms in a wide range of cell types and tissues from a single gene located on chromosome 8 in humans (PMID: 8633055, 8698233). Until 2010, this locus was named plectin 1 (symbol PLEC1 in human; Plec1 in mouse and rat) and the gene product had been referred to as 'hemidesmosomal protein 1' or 'plectin 1, intermediate filament binding 500kDa'. These names were superseded by plectin. The plectin gene locus in mouse on chromosome 15 has been analyzed in detail (PMID: 10556294, 14559777), revealing a genomic exon-intron organization with well over 40 exons spanning over 62 kb and an unusual 5' transcript complexity of plectin isoforms. Eleven exons (1-1j) have been identified that alternatively splice directly into a common exon 2 which is the first exon to encode plectin's highly conserved actin binding domain (ABD). Three additional exons (-1, 0a, and 0) splice into an alternative first coding exon (1c), and two additional exons (2alpha and 3alpha) are optionally spliced within the exons encoding the acting binding domain (exons 2-8). Analysis of the human locus has identified eight of the eleven alternative 5' exons found in mouse and rat (PMID: 14672974); exons 1i, 1j and 1h have not been confirmed in human. Furthermore, isoforms lacking the central rod domain encoded by exon 31 have been detected in mouse (PMID:10556294), rat (PMID: 9177781), and human (PMID: 11441066, 10780662, 20052759). The short alternative amino-terminal sequences encoded by the different first exons direct the targeting of the various isoforms to distinct subcellular locations (PMID: 14559777). As the expression of specific plectin isoforms was found to be dependent on cell type (tissue) and stage of development (PMID: 10556294, 12542521, 17389230) it appears that each cell type (tissue) contains a unique set (proportion and composition) of plectin isoforms, as if custom-made for specific requirements of the particular cells. Concordantly, individual isoforms were found to carry out distinct and specific functions (PMID: 14559777, 12542521, 18541706). In 1996, a number of groups reported that patients suffering from epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) lacked plectin expression in skin and muscle tissues due to defects in the plectin gene (PMID: 8698233, 8941634, 8636409, 8894687, 8696340). Two other subtypes of plectin-related EBS have been described: EBS-pyloric atresia (PA) and EBS-Ogna. For reviews of plectin-related diseases see PMID: 15810881, 19945614. Mutations in the plectin gene related to human diseases should be named based on the position in NM_000445 (variant 1, isoform 1c), unless the mutation is located within one of the other alternative first exons, in which case the position in the respective Reference Sequence should be used. [provided by RefSeq, Aug 2011]
Mouse(18810) plectin
Rat(64204) plectin
dog(482083) plectin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA025967 Anti-PLEC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
HPA029906 Anti-PLEC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB4301219 Anti-PLEC antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
P9318 Monoclonal Anti-Plectin antibody produced in mouse clone 7A8, ascites fluid marsupial (Ptoorous tridactylis PtK2 cell line), rat
dot blot, ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, microarray, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0899 AQUA Peptide AGTLSITEFADMLSGNAGGF[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201378 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000445 Rosetta Predictions human pricing
NM_201378 Rosetta Predictions human pricing
NM_201379 Rosetta Predictions human pricing
NM_201380 Rosetta Predictions human pricing
NM_201381 Rosetta Predictions human pricing
NM_201382 Rosetta Predictions human pricing
NM_201383 Rosetta Predictions human pricing
NM_201384 Rosetta Predictions human pricing
NM_022401 Rosetta Predictions rat pricing
NM_011117 Rosetta Predictions mouse pricing
NM_201385 Rosetta Predictions mouse pricing
NM_201386 Rosetta Predictions mouse pricing
NM_201387 Rosetta Predictions mouse pricing
NM_201388 Rosetta Predictions mouse pricing
NM_201389 Rosetta Predictions mouse pricing
NM_201390 Rosetta Predictions mouse pricing
NM_201391 Rosetta Predictions mouse pricing
NM_201392 Rosetta Predictions mouse pricing
NM_201393 Rosetta Predictions mouse pricing
NM_201394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222666 predicted 11847
2 SASI_Hs01_00222667 predicted 6832
3 SASI_Hs01_00222668 predicted 6835
4 SASI_Hs01_00222669 predicted 8855
5 SASI_Hs01_00222670 predicted 7452
6 SASI_Hs01_00222671 predicted 11067
7 SASI_Hs01_00222672 predicted 9849
8 SASI_Hs01_00222673 predicted 1426
9 SASI_Hs01_00222674 predicted 2246
10 SASI_Hs01_00222675 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206594 predicted 11714
2 SASI_Hs01_00206595 predicted 6697
3 SASI_Hs01_00206596 predicted 6715
4 SASI_Hs01_00206597 predicted 8724
5 SASI_Hs01_00206598 predicted 7320
6 SASI_Hs01_00206599 predicted 10933
7 SASI_Hs01_00206600 predicted 9722
8 SASI_Hs01_00206601 predicted 1289
9 SASI_Hs01_00206602 predicted 2118
10 SASI_Hs01_00206603 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149770 predicted 11845
2 SASI_Hs01_00149771 predicted 6828
3 SASI_Hs01_00149772 predicted 6840
4 SASI_Hs01_00149773 predicted 8853
5 SASI_Hs01_00149774 predicted 7443
6 SASI_Hs01_00149775 predicted 11058
7 SASI_Hs01_00149776 predicted 9840
8 SASI_Hs01_00149777 predicted 1414
9 SASI_Hs01_00149778 predicted 2243
10 SASI_Hs01_00149779 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053018 predicted 12336
2 SASI_Hs01_00053019 predicted 7318
3 SASI_Hs01_00053020 predicted 7330
4 SASI_Hs01_00053021 predicted 9356
5 SASI_Hs01_00053022 predicted 7941
6 SASI_Hs01_00053023 predicted 11561
7 SASI_Hs01_00053024 predicted 10341
8 SASI_Hs01_00053025 predicted 1917
9 SASI_Hs01_00053026 predicted 2748
10 SASI_Hs01_00053027 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101445 predicted 11736
2 SASI_Hs01_00101446 predicted 6717
3 SASI_Hs01_00101447 predicted 6728
4 SASI_Hs01_00101448 predicted 8749
5 SASI_Hs01_00101449 predicted 7341
6 SASI_Hs01_00101450 predicted 10959
7 SASI_Hs01_00101451 predicted 9738
8 SASI_Hs01_00101452 predicted 1317
9 SASI_Hs01_00101453 predicted 2145
10 SASI_Hs01_00101454 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245282 predicted 11766
2 SASI_Hs01_00245283 predicted 6744
3 SASI_Hs01_00245284 predicted 6758
4 SASI_Hs01_00245285 predicted 8779
5 SASI_Hs01_00245286 predicted 7373
6 SASI_Hs01_00245287 predicted 10988
7 SASI_Hs01_00245288 predicted 9768
8 SASI_Hs01_00245289 predicted 1344
9 SASI_Hs01_00245290 predicted 2168
10 SASI_Hs01_00245291 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020930 predicted 11782
2 SASI_Hs01_00020931 predicted 6764
3 SASI_Hs01_00020932 predicted 6770
4 SASI_Hs01_00020933 predicted 8794
5 SASI_Hs01_00020934 predicted 7387
6 SASI_Hs01_00020935 predicted 11001
7 SASI_Hs01_00020936 predicted 9778
8 SASI_Hs01_00020937 predicted 1359
9 SASI_Hs01_00020938 predicted 2180
10 SASI_Hs01_00020939 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090107 predicted 11887
2 SASI_Hs01_00090108 predicted 6874
3 SASI_Hs01_00090109 predicted 6886
4 SASI_Hs01_00090110 predicted 8903
5 SASI_Hs01_00090111 predicted 7497
6 SASI_Hs01_00090112 predicted 11107
7 SASI_Hs01_00090113 predicted 9887
8 SASI_Hs01_00090114 predicted 1467
9 SASI_Hs01_00090115 predicted 2293
10 SASI_Hs01_00090116 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263173 predicted 4315
2 SASI_Rn01_00081346 predicted 2629
3 SASI_Rn01_00081347 predicted 12168
4 SASI_Rn01_00081348 predicted 11396
5 SASI_Rn01_00081349 predicted 12911
6 SASI_Rn01_00081351 predicted 11527
7 SASI_Rn01_00081352 predicted 1187
8 SASI_Rn01_00081353 predicted 12872
9 SASI_Rn01_00081354 predicted 7134
10 SASI_Rn02_00263174 predicted 9203
11 SASI_Rn01_00081345 predicted 1764
12 SASI_Rn01_00081350 predicted 13835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140948 predicted 1431
2 SASI_Mm01_00140950 predicted 11057
3 SASI_Mm01_00140951 predicted 12024
4 SASI_Mm01_00140952 predicted 2295
5 SASI_Mm01_00140953 predicted 1272
6 SASI_Mm01_00140954 predicted 12272
7 SASI_Mm02_00319933 predicted 12769
8 SASI_Mm01_00140955 predicted 11191
9 SASI_Mm01_00140956 predicted 1037
10 SASI_Mm01_00140957 predicted 11088
11 SASI_Mm01_00140949 predicted 12327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145606 predicted 1358
2 SASI_Mm01_00145608 predicted 10997
3 SASI_Mm01_00145609 predicted 11956
4 SASI_Mm01_00145610 predicted 2235
5 SASI_Mm01_00145611 predicted 1210
6 SASI_Mm01_00145612 predicted 12208
7 SASI_Mm02_00351556 predicted 12708
8 SASI_Mm01_00145613 predicted 11125
9 SASI_Mm01_00145614 predicted 968
10 SASI_Mm01_00145615 predicted 11015
11 SASI_Mm01_00145607 predicted 12270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191523 predicted 1427
2 SASI_Mm01_00191525 predicted 11061
3 SASI_Mm01_00191526 predicted 12014
4 SASI_Mm01_00191527 predicted 2295
5 SASI_Mm01_00191528 predicted 1275
6 SASI_Mm01_00191529 predicted 12273
7 SASI_Mm02_00351557 predicted 12766
8 SASI_Mm01_00191530 predicted 11182
9 SASI_Mm01_00191531 predicted 1024
10 SASI_Mm01_00191532 predicted 11083
11 SASI_Mm01_00191524 predicted 12331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047977 predicted 1451
2 SASI_Mm01_00047979 predicted 11087
3 SASI_Mm01_00047980 predicted 12050
4 SASI_Mm01_00047981 predicted 2319
5 SASI_Mm01_00047982 predicted 1300
6 SASI_Mm01_00047983 predicted 12293
7 SASI_Mm02_00351558 predicted 12800
8 SASI_Mm01_00047984 predicted 11214
9 SASI_Mm01_00047985 predicted 1062
10 SASI_Mm01_00047986 predicted 11110
11 SASI_Mm01_00047978 predicted 12352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021339 predicted 1409
2 SASI_Mm01_00021341 predicted 11051
3 SASI_Mm01_00021342 predicted 12005
4 SASI_Mm01_00021343 predicted 2282
5 SASI_Mm01_00021344 predicted 1261
6 SASI_Mm01_00021345 predicted 12255
7 SASI_Mm02_00351559 predicted 12761
8 SASI_Mm01_00021346 predicted 11173
9 SASI_Mm01_00021347 predicted 1015
10 SASI_Mm01_00021348 predicted 11071
11 SASI_Mm01_00021340 predicted 12315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080239 predicted 1944
2 SASI_Mm01_00080241 predicted 11580
3 SASI_Mm01_00080242 predicted 12537
4 SASI_Mm01_00080243 predicted 2818
5 SASI_Mm01_00080244 predicted 1793
6 SASI_Mm01_00080245 predicted 12787
7 SASI_Mm02_00351560 predicted 13290
8 SASI_Mm01_00080246 predicted 11705
9 SASI_Mm01_00080247 predicted 1555
10 SASI_Mm01_00080248 predicted 11605
11 SASI_Mm01_00080240 predicted 12848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188709 predicted 1359
2 SASI_Mm01_00188711 predicted 10998
3 SASI_Mm01_00188712 predicted 11950
4 SASI_Mm01_00188713 predicted 2231
5 SASI_Mm01_00188714 predicted 1207
6 SASI_Mm01_00188715 predicted 12207
7 SASI_Mm02_00351561 predicted 12707
8 SASI_Mm01_00188716 predicted 11124
9 SASI_Mm01_00188717 predicted 970
10 SASI_Mm01_00188718 predicted 11023
11 SASI_Mm01_00188710 predicted 12270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048743 predicted 1504
2 SASI_Mm01_00048745 predicted 11139
3 SASI_Mm01_00048746 predicted 12104
4 SASI_Mm01_00048747 predicted 2382
5 SASI_Mm01_00048748 predicted 1354
6 SASI_Mm01_00048749 predicted 12356
7 SASI_Mm02_00351562 predicted 12855
8 SASI_Mm01_00048750 predicted 11275
9 SASI_Mm01_00048751 predicted 1113
10 SASI_Mm01_00048752 predicted 11163
11 SASI_Mm01_00048744 predicted 12415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082421 predicted 1335
2 SASI_Mm01_00082423 predicted 10972
3 SASI_Mm01_00082424 predicted 11924
4 SASI_Mm01_00082425 predicted 2199
5 SASI_Mm01_00082426 predicted 1184
6 SASI_Mm01_00082427 predicted 12183
7 SASI_Mm02_00351563 predicted 12679
8 SASI_Mm01_00082428 predicted 11101
9 SASI_Mm01_00082429 predicted 939
10 SASI_Mm01_00082430 predicted 10994
11 SASI_Mm01_00082422 predicted 12239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124109 predicted 1447
2 SASI_Mm01_00124111 predicted 11087
3 SASI_Mm01_00124112 predicted 12047
4 SASI_Mm01_00124113 predicted 2320
5 SASI_Mm01_00124114 predicted 1300
6 SASI_Mm01_00124115 predicted 12294
7 SASI_Mm02_00351564 predicted 12799
8 SASI_Mm01_00124116 predicted 11210
9 SASI_Mm01_00124117 predicted 1062
10 SASI_Mm01_00124118 predicted 11112
11 SASI_Mm01_00124110 predicted 12361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161750 predicted 1511
2 SASI_Mm01_00161752 predicted 11138
3 SASI_Mm01_00161753 predicted 12103
4 SASI_Mm01_00161754 predicted 2376
5 SASI_Mm01_00161755 predicted 1354
6 SASI_Mm01_00161756 predicted 12354
7 SASI_Mm02_00351565 predicted 12852
8 SASI_Mm01_00161757 predicted 11268
9 SASI_Mm01_00161758 predicted 1110
10 SASI_Mm01_00161759 predicted 11162
11 SASI_Mm01_00161751 predicted 12417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201394
VALIDATED
PLEC MISSION shRNA Bacterial Glycerol Stock
plectin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-778s21c1
Sequence:CCGGGCCCATGCTCATAGATATGAACTCGAGTTCATATCTATGAGCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-778s1c1
Sequence:CCGGGCCCATGCTCATAGATATGAACTCGAGTTCATATCTATGAGCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-14461s1c1
Sequence:CCGGCCATTGGAGCTATGCTTTGTACTCGAGTACAAAGCATAGCTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-3970s1c1
Sequence:CCGGCCAGAAGTTTGCTAAGCAGTACTCGAGTACTGCTTAGCAAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-8264s1c1
Sequence:CCGGCTGTTACTGAAGCCCACCAATCTCGAGATTGGTGGGCTTCAGTAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-12727s1c1
Sequence:CCGGCGTCGTCAAGTCTATGATCATCTCGAGATGATCATAGACTTGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-8264s21c1
Sequence:CCGGCTGTTACTGAAGCCCACCAATCTCGAGATTGGTGGGCTTCAGTAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-12727s21c1
Sequence:CCGGCGTCGTCAAGTCTATGATCATCTCGAGATGATCATAGACTTGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-3970s21c1
Sequence:CCGGCCAGAAGTTTGCTAAGCAGTACTCGAGTACTGCTTAGCAAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201394.1-14461s21c1
Sequence:CCGGCCATTGGAGCTATGCTTTGTACTCGAGTACAAAGCATAGCTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201394
VALIDATED
PLEC MISSION shRNA shRNA Plasmid DNA
plectin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-778s21c1
Sequence:CCGGGCCCATGCTCATAGATATGAACTCGAGTTCATATCTATGAGCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-778s1c1
Sequence:CCGGGCCCATGCTCATAGATATGAACTCGAGTTCATATCTATGAGCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-14461s1c1
Sequence:CCGGCCATTGGAGCTATGCTTTGTACTCGAGTACAAAGCATAGCTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-3970s1c1
Sequence:CCGGCCAGAAGTTTGCTAAGCAGTACTCGAGTACTGCTTAGCAAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-8264s1c1
Sequence:CCGGCTGTTACTGAAGCCCACCAATCTCGAGATTGGTGGGCTTCAGTAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-12727s1c1
Sequence:CCGGCGTCGTCAAGTCTATGATCATCTCGAGATGATCATAGACTTGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-8264s21c1
Sequence:CCGGCTGTTACTGAAGCCCACCAATCTCGAGATTGGTGGGCTTCAGTAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-12727s21c1
Sequence:CCGGCGTCGTCAAGTCTATGATCATCTCGAGATGATCATAGACTTGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-3970s21c1
Sequence:CCGGCCAGAAGTTTGCTAAGCAGTACTCGAGTACTGCTTAGCAAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201394.1-14461s21c1
Sequence:CCGGCCATTGGAGCTATGCTTTGTACTCGAGTACAAAGCATAGCTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201394
VALIDATED
PLEC MISSION shRNA Lentiviral Transduction Particles
plectin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-778s21c1
Sequence:CCGGGCCCATGCTCATAGATATGAACTCGAGTTCATATCTATGAGCATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-778s1c1
Sequence:CCGGGCCCATGCTCATAGATATGAACTCGAGTTCATATCTATGAGCATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-14461s1c1
Sequence:CCGGCCATTGGAGCTATGCTTTGTACTCGAGTACAAAGCATAGCTCCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-3970s1c1
Sequence:CCGGCCAGAAGTTTGCTAAGCAGTACTCGAGTACTGCTTAGCAAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-8264s1c1
Sequence:CCGGCTGTTACTGAAGCCCACCAATCTCGAGATTGGTGGGCTTCAGTAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201394.1-12727s1c1
Sequence:CCGGCGTCGTCAAGTCTATGATCATCTCGAGATGATCATAGACTTGACGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-8264s21c1
Sequence:CCGGCTGTTACTGAAGCCCACCAATCTCGAGATTGGTGGGCTTCAGTAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-12727s21c1
Sequence:CCGGCGTCGTCAAGTCTATGATCATCTCGAGATGATCATAGACTTGACGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201394.1-3970s21c1
Sequence:CCGGCCAGAAGTTTGCTAAGCAGTACTCGAGTACTGCTTAGCAAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201394.1-14461s21c1
Sequence:CCGGCCATTGGAGCTATGCTTTGTACTCGAGTACAAAGCATAGCTCCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201378
VALIDATED
PLEC MISSION shRNA Bacterial Glycerol Stock
plectin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201378.1-1641s21c1
Sequence:CCGGGCACCAGTCCATCGAAGAATTCTCGAGAATTCTTCGATGGACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-2194s1c1
Sequence:CCGGCGTAGGAAATACAGTTGTGATCTCGAGATCACAACTGTATTTCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-12168s1c1
Sequence:CCGGCCTCTTCGATGAGGAGATGAACTCGAGTTCATCTCCTCATCGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-12174s1c1
Sequence:CCGGCGATGAGGAGATGAACGAGATCTCGAGATCTCGTTCATCTCCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-1641s1c1
Sequence:CCGGGCACCAGTCCATCGAAGAATTCTCGAGAATTCTTCGATGGACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-14206s1c1
Sequence:CCGGGCCTTCCATGTCGGCCTCTAACTCGAGTTAGAGGCCGACATGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201378.1-14206s21c1
Sequence:CCGGGCCTTCCATGTCGGCCTCTAACTCGAGTTAGAGGCCGACATGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_201378.1-2194s21c1
Sequence:CCGGCGTAGGAAATACAGTTGTGATCTCGAGATCACAACTGTATTTCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_201378.1-12168s21c1
Sequence:CCGGCCTCTTCGATGAGGAGATGAACTCGAGTTCATCTCCTCATCGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201378
VALIDATED
PLEC MISSION shRNA shRNA Plasmid DNA
plectin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201378.1-1641s21c1
Sequence:CCGGGCACCAGTCCATCGAAGAATTCTCGAGAATTCTTCGATGGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-2194s1c1
Sequence:CCGGCGTAGGAAATACAGTTGTGATCTCGAGATCACAACTGTATTTCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-12168s1c1
Sequence:CCGGCCTCTTCGATGAGGAGATGAACTCGAGTTCATCTCCTCATCGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-12174s1c1
Sequence:CCGGCGATGAGGAGATGAACGAGATCTCGAGATCTCGTTCATCTCCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-1641s1c1
Sequence:CCGGGCACCAGTCCATCGAAGAATTCTCGAGAATTCTTCGATGGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-14206s1c1
Sequence:CCGGGCCTTCCATGTCGGCCTCTAACTCGAGTTAGAGGCCGACATGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201378.1-14206s21c1
Sequence:CCGGGCCTTCCATGTCGGCCTCTAACTCGAGTTAGAGGCCGACATGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_201378.1-2194s21c1
Sequence:CCGGCGTAGGAAATACAGTTGTGATCTCGAGATCACAACTGTATTTCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_201378.1-12168s21c1
Sequence:CCGGCCTCTTCGATGAGGAGATGAACTCGAGTTCATCTCCTCATCGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201378
VALIDATED
PLEC MISSION shRNA Lentiviral Transduction Particles
plectin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201378.1-1641s21c1
Sequence:CCGGGCACCAGTCCATCGAAGAATTCTCGAGAATTCTTCGATGGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-2194s1c1
Sequence:CCGGCGTAGGAAATACAGTTGTGATCTCGAGATCACAACTGTATTTCCTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-12168s1c1
Sequence:CCGGCCTCTTCGATGAGGAGATGAACTCGAGTTCATCTCCTCATCGAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-12174s1c1
Sequence:CCGGCGATGAGGAGATGAACGAGATCTCGAGATCTCGTTCATCTCCTCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-1641s1c1
Sequence:CCGGGCACCAGTCCATCGAAGAATTCTCGAGAATTCTTCGATGGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_201378.1-14206s1c1
Sequence:CCGGGCCTTCCATGTCGGCCTCTAACTCGAGTTAGAGGCCGACATGGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201378.1-14206s21c1
Sequence:CCGGGCCTTCCATGTCGGCCTCTAACTCGAGTTAGAGGCCGACATGGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_201378.1-2194s21c1
Sequence:CCGGCGTAGGAAATACAGTTGTGATCTCGAGATCACAACTGTATTTCCTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_201378.1-12168s21c1
Sequence:CCGGCCTCTTCGATGAGGAGATGAACTCGAGTTCATCTCCTCATCGAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)