EMAIL THIS PAGE TO A FRIEND

PLEK2

pleckstrin 2

37 Gene Product Result for
UniProtKB ID: Q9NYT0, Q96JT0
Gene ID:
Mouse(27260) pleckstrin 2
Rat(314260) pleckstrin 2
cow(784941) pleckstrin 2
sheep(101113855) pleckstrin 2
Zebrafish(567753) pleckstrin 2
Horse(100052761) pleckstrin 2
dog(480362) pleckstrin 2
chicken(423278) pleckstrin 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016445 Rosetta Predictions human pricing
NM_001114180 Rosetta Predictions rat pricing
NM_013738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225314 predicted 838
2 SASI_Hs01_00225315 predicted 600
3 SASI_Hs01_00225316 predicted 1080
4 SASI_Hs01_00225317 predicted 870
5 SASI_Hs01_00225318 predicted 952
6 SASI_Hs01_00225319 predicted 325
7 SASI_Hs01_00225320 predicted 548
8 SASI_Hs01_00225321 predicted 999
9 SASI_Hs01_00225322 predicted 865
10 SASI_Hs01_00225323 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252193 predicted 801
2 SASI_Rn02_00252194 predicted 348
3 SASI_Rn02_00252195 predicted 927
4 SASI_Rn02_00252196 predicted 967
5 SASI_Rn02_00252197 predicted 832
6 SASI_Rn02_00252198 predicted 854
7 SASI_Rn02_00252199 predicted 232
8 SASI_Rn02_00252200 predicted 759
9 SASI_Rn02_00252201 predicted 282
10 SASI_Rn02_00252202 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119387 predicted 802
2 SASI_Mm01_00119388 predicted 822
3 SASI_Mm01_00119389 predicted 378
4 SASI_Mm01_00119390 predicted 911
5 SASI_Mm01_00119392 predicted 225
6 SASI_Mm01_00119393 predicted 747
7 SASI_Mm01_00119394 predicted 939
8 SASI_Mm01_00119395 predicted 228
9 SASI_Mm01_00119396 predicted 964
10 SASI_Mm02_00322679 predicted 347
11 SASI_Mm01_00119391 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016445
VALIDATED
PLEK2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-1172s1c1
Sequence:CCGGCCTGGAGAATGGGAGTGTTAACTCGAGTTAACACTCCCATTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-1011s1c1
Sequence:CCGGACCTCTTCAAAGTGATTACTACTCGAGTAGTAATCACTTTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-875s1c1
Sequence:CCGGCCAGCTTTCCTGCATTACTATCTCGAGATAGTAATGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-439s1c1
Sequence:CCGGGCATCGCATTGTGGACAAGATCTCGAGATCTTGTCCACAATGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016445.1-959s1c1
Sequence:CCGGGCTCTGGAAGATAATGGCGTTCTCGAGAACGCCATTATCTTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-439s21c1
Sequence:CCGGGCATCGCATTGTGGACAAGATCTCGAGATCTTGTCCACAATGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016445.1-1172s21c1
Sequence:CCGGCCTGGAGAATGGGAGTGTTAACTCGAGTTAACACTCCCATTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-875s21c1
Sequence:CCGGCCAGCTTTCCTGCATTACTATCTCGAGATAGTAATGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-1011s21c1
Sequence:CCGGACCTCTTCAAAGTGATTACTACTCGAGTAGTAATCACTTTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016445
VALIDATED
PLEK2 MISSION shRNA shRNA Plasmid DNA
pleckstrin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-1172s1c1
Sequence:CCGGCCTGGAGAATGGGAGTGTTAACTCGAGTTAACACTCCCATTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-1011s1c1
Sequence:CCGGACCTCTTCAAAGTGATTACTACTCGAGTAGTAATCACTTTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-875s1c1
Sequence:CCGGCCAGCTTTCCTGCATTACTATCTCGAGATAGTAATGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-439s1c1
Sequence:CCGGGCATCGCATTGTGGACAAGATCTCGAGATCTTGTCCACAATGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016445.1-959s1c1
Sequence:CCGGGCTCTGGAAGATAATGGCGTTCTCGAGAACGCCATTATCTTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-439s21c1
Sequence:CCGGGCATCGCATTGTGGACAAGATCTCGAGATCTTGTCCACAATGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016445.1-1172s21c1
Sequence:CCGGCCTGGAGAATGGGAGTGTTAACTCGAGTTAACACTCCCATTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-875s21c1
Sequence:CCGGCCAGCTTTCCTGCATTACTATCTCGAGATAGTAATGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-1011s21c1
Sequence:CCGGACCTCTTCAAAGTGATTACTACTCGAGTAGTAATCACTTTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016445
VALIDATED
PLEK2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-1172s1c1
Sequence:CCGGCCTGGAGAATGGGAGTGTTAACTCGAGTTAACACTCCCATTCTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-1011s1c1
Sequence:CCGGACCTCTTCAAAGTGATTACTACTCGAGTAGTAATCACTTTGAAGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-875s1c1
Sequence:CCGGCCAGCTTTCCTGCATTACTATCTCGAGATAGTAATGCAGGAAAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016445.1-439s1c1
Sequence:CCGGGCATCGCATTGTGGACAAGATCTCGAGATCTTGTCCACAATGCGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016445.1-959s1c1
Sequence:CCGGGCTCTGGAAGATAATGGCGTTCTCGAGAACGCCATTATCTTCCAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-439s21c1
Sequence:CCGGGCATCGCATTGTGGACAAGATCTCGAGATCTTGTCCACAATGCGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016445.1-1172s21c1
Sequence:CCGGCCTGGAGAATGGGAGTGTTAACTCGAGTTAACACTCCCATTCTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-875s21c1
Sequence:CCGGCCAGCTTTCCTGCATTACTATCTCGAGATAGTAATGCAGGAAAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016445.1-1011s21c1
Sequence:CCGGACCTCTTCAAAGTGATTACTACTCGAGTAGTAATCACTTTGAAGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013738
PLEK2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013738.1-1341s1c1
Sequence:CCGGCCTTCCTATGACCAACTTTAACTCGAGTTAAAGTTGGTCATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-829s21c1
Sequence:CCGGCCAGCTTTCCTGCACTACTATCTCGAGATAGTAGTGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-841s1c1
Sequence:CCGGCCAGCTTTCCTGCACTACTATCTCGAGATAGTAGTGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-405s1c1
Sequence:CCGGGCATCGAATTGTGGACAAGATCTCGAGATCTTGTCCACAATTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-222s1c1
Sequence:CCGGGCCGCTCCTCATTAAACTGAACTCGAGTTCAGTTTAATGAGGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-363s1c1
Sequence:CCGGCATACTGAAGAACTCCTTCAACTCGAGTTGAAGGAGTTCTTCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-351s21c1
Sequence:CCGGCATACTGAAGAACTCCTTCAACTCGAGTTGAAGGAGTTCTTCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013738.3-1328s21c1
Sequence:CCGGCCTTCCTATGACCAACTTTAACTCGAGTTAAAGTTGGTCATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-986s21c1
Sequence:CCGGAGGATGACACACACTATTATACTCGAGTATAATAGTGTGTGTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-794s21c1
Sequence:CCGGACTGGAAGGTGCGCAGATTTGCTCGAGCAAATCTGCGCACCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013738
PLEK2 MISSION shRNA shRNA Plasmid DNA
pleckstrin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013738.1-1341s1c1
Sequence:CCGGCCTTCCTATGACCAACTTTAACTCGAGTTAAAGTTGGTCATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-829s21c1
Sequence:CCGGCCAGCTTTCCTGCACTACTATCTCGAGATAGTAGTGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-841s1c1
Sequence:CCGGCCAGCTTTCCTGCACTACTATCTCGAGATAGTAGTGCAGGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-405s1c1
Sequence:CCGGGCATCGAATTGTGGACAAGATCTCGAGATCTTGTCCACAATTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-222s1c1
Sequence:CCGGGCCGCTCCTCATTAAACTGAACTCGAGTTCAGTTTAATGAGGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-363s1c1
Sequence:CCGGCATACTGAAGAACTCCTTCAACTCGAGTTGAAGGAGTTCTTCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-351s21c1
Sequence:CCGGCATACTGAAGAACTCCTTCAACTCGAGTTGAAGGAGTTCTTCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013738.3-1328s21c1
Sequence:CCGGCCTTCCTATGACCAACTTTAACTCGAGTTAAAGTTGGTCATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-986s21c1
Sequence:CCGGAGGATGACACACACTATTATACTCGAGTATAATAGTGTGTGTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-794s21c1
Sequence:CCGGACTGGAAGGTGCGCAGATTTGCTCGAGCAAATCTGCGCACCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013738
PLEK2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013738.1-1341s1c1
Sequence:CCGGCCTTCCTATGACCAACTTTAACTCGAGTTAAAGTTGGTCATAGGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-829s21c1
Sequence:CCGGCCAGCTTTCCTGCACTACTATCTCGAGATAGTAGTGCAGGAAAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-841s1c1
Sequence:CCGGCCAGCTTTCCTGCACTACTATCTCGAGATAGTAGTGCAGGAAAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-405s1c1
Sequence:CCGGGCATCGAATTGTGGACAAGATCTCGAGATCTTGTCCACAATTCGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-222s1c1
Sequence:CCGGGCCGCTCCTCATTAAACTGAACTCGAGTTCAGTTTAATGAGGAGCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013738.1-363s1c1
Sequence:CCGGCATACTGAAGAACTCCTTCAACTCGAGTTGAAGGAGTTCTTCAGTATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-351s21c1
Sequence:CCGGCATACTGAAGAACTCCTTCAACTCGAGTTGAAGGAGTTCTTCAGTATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013738.3-1328s21c1
Sequence:CCGGCCTTCCTATGACCAACTTTAACTCGAGTTAAAGTTGGTCATAGGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-986s21c1
Sequence:CCGGAGGATGACACACACTATTATACTCGAGTATAATAGTGTGTGTCATCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013738.3-794s21c1
Sequence:CCGGACTGGAAGGTGCGCAGATTTGCTCGAGCAAATCTGCGCACCTTCCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???