EMAIL THIS PAGE TO A FRIEND

PLEKHA1

pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1

175 Gene Product Result for
Synonyms: TAPP1
UniProtKB ID: Q9HB21, B3KQ55, D3DRE2, Q9BVK0
Gene ID:
Human(59338) Summary: This gene encodes a pleckstrin homology domain-containing adapter protein. The encoded protein is localized to the plasma membrane where it specifically binds phosphatidylinositol 3,4-bisphosphate. This protein may be involved in the formation of signaling complexes in the plasma membrane. Polymorphisms in this gene are associated with age-related macular degeneration. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Sep 2010]
Mouse(101476) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Rat(361659) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Zebrafish(406745) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
chicken(423940) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
dog(477851) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Horse(100058481) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
domestic cat(101091404) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
naked mole-rat(101703424) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
domestic guinea pig(100713709) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
cow(513040) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
sheep(101110806) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137611 MISSION® esiRNA esiRNA human PLEKHA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001974 Rosetta Predictions human pricing
NM_021622 Rosetta Predictions human pricing
NM_001079894 Rosetta Predictions rat pricing
NM_133942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223673 predicted 671
2 SASI_Hs01_00223676 predicted 848
3 SASI_Hs01_00223679 predicted 652
4 SASI_Hs01_00223680 predicted 917
5 SASI_Hs02_00304051 predicted 1114
6 SASI_Hs01_00223682 predicted 1229
7 SASI_Hs02_00304052 predicted 687
8 SASI_Hs02_00304053 predicted 398
9 SASI_Hs02_00304054 predicted 401
10 SASI_Hs02_00304055 predicted 853
11 SASI_Hs01_00223674 predicted 835
12 SASI_Hs01_00223675 predicted 395
13 SASI_Hs01_00223677 predicted 868
14 SASI_Hs01_00223678 predicted 421
15 SASI_Hs01_00223681 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114102 predicted 606
2 SASI_Hs01_00114105 predicted 795
3 SASI_Hs01_00114108 predicted 591
4 SASI_Hs01_00114109 predicted 860
5 SASI_Hs02_00354958 predicted 1058
6 SASI_Hs01_00114111 predicted 1170
7 SASI_Hs02_00354959 predicted 629
8 SASI_Hs02_00354960 predicted 344
9 SASI_Hs02_00354961 predicted 342
10 SASI_Hs02_00354962 predicted 802
11 SASI_Hs01_00114103 predicted 776
12 SASI_Hs01_00114104 predicted 335
13 SASI_Hs01_00114106 predicted 817
14 SASI_Hs01_00114107 predicted 372
15 SASI_Hs01_00114110 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208249 predicted 915
2 SASI_Rn02_00208250 predicted 533
3 SASI_Rn02_00208251 predicted 914
4 SASI_Rn02_00208252 predicted 494
5 SASI_Rn02_00208253 predicted 830
6 SASI_Rn02_00208254 predicted 1095
7 SASI_Rn02_00208255 predicted 1050
8 SASI_Rn02_00208256 predicted 590
9 SASI_Rn02_00208257 predicted 523
10 SASI_Rn02_00208258 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339045 predicted 740
2 SASI_Mm01_00162667 predicted 516
3 SASI_Mm02_00339046 predicted 207
4 SASI_Mm02_00339047 predicted 648
5 SASI_Mm02_00339048 predicted 677
6 SASI_Mm01_00162669 predicted 355
7 SASI_Mm01_00162668 predicted 691
8 SASI_Mm02_00339049 predicted 411
9 SASI_Mm01_00162673 predicted 653
10 SASI_Mm02_00339050 predicted 1098
11 SASI_Mm01_00162670 predicted 369
12 SASI_Mm01_00162671 predicted 693
13 SASI_Mm01_00162672 predicted 1057
14 SASI_Mm01_00162674 predicted 525
15 SASI_Mm01_00162675 predicted 212
16 SASI_Mm01_00162676 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021622
PLEKHA1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-1234s21c1
Sequence:CCGGGACCTAGTAGACTTGGACGATCTCGAGATCGTCCAAGTCTACTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-897s21c1
Sequence:CCGGGCACAGTTGGATTAAAGCAGTCTCGAGACTGCTTTAATCCAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-361s21c1
Sequence:CCGGGACCTAGTGGAATGGGTAAATCTCGAGATTTACCCATTCCACTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-1162s21c1
Sequence:CCGGCCAGCTTCCAAAGTGACTGAACTCGAGTTCAGTCACTTTGGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2560s1c1
Sequence:CCGGCCAGCTTCCAAAGTGACTGAACTCGAGTTCAGTCACTTTGGAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2632s1c1
Sequence:CCGGGACCTAGTAGACTTGGACGATCTCGAGATCGTCCAAGTCTACTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-1658s1c1
Sequence:CCGGCAAAGGTTAGCGATGCTACTACTCGAGTAGTAGCATCGCTAACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-1759s1c1
Sequence:CCGGGACCTAGTGGAATGGGTAAATCTCGAGATTTACCCATTCCACTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021622.2-1713s1c1
Sequence:CCGGGAATGCAGGAATGAGGAAGTACTCGAGTACTTCCTCATTCCTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2295s1c1
Sequence:CCGGGCACAGTTGGATTAAAGCAGTCTCGAGACTGCTTTAATCCAACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021622.2-2581s1c1
Sequence:CCGGCAAGCTCTGTTAAGACCTCAACTCGAGTTGAGGTCTTAACAGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021622
PLEKHA1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-1234s21c1
Sequence:CCGGGACCTAGTAGACTTGGACGATCTCGAGATCGTCCAAGTCTACTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-897s21c1
Sequence:CCGGGCACAGTTGGATTAAAGCAGTCTCGAGACTGCTTTAATCCAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-361s21c1
Sequence:CCGGGACCTAGTGGAATGGGTAAATCTCGAGATTTACCCATTCCACTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-1162s21c1
Sequence:CCGGCCAGCTTCCAAAGTGACTGAACTCGAGTTCAGTCACTTTGGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2560s1c1
Sequence:CCGGCCAGCTTCCAAAGTGACTGAACTCGAGTTCAGTCACTTTGGAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2632s1c1
Sequence:CCGGGACCTAGTAGACTTGGACGATCTCGAGATCGTCCAAGTCTACTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-1658s1c1
Sequence:CCGGCAAAGGTTAGCGATGCTACTACTCGAGTAGTAGCATCGCTAACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-1759s1c1
Sequence:CCGGGACCTAGTGGAATGGGTAAATCTCGAGATTTACCCATTCCACTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021622.2-1713s1c1
Sequence:CCGGGAATGCAGGAATGAGGAAGTACTCGAGTACTTCCTCATTCCTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2295s1c1
Sequence:CCGGGCACAGTTGGATTAAAGCAGTCTCGAGACTGCTTTAATCCAACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021622.2-2581s1c1
Sequence:CCGGCAAGCTCTGTTAAGACCTCAACTCGAGTTGAGGTCTTAACAGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021622
PLEKHA1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-1234s21c1
Sequence:CCGGGACCTAGTAGACTTGGACGATCTCGAGATCGTCCAAGTCTACTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-897s21c1
Sequence:CCGGGCACAGTTGGATTAAAGCAGTCTCGAGACTGCTTTAATCCAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-361s21c1
Sequence:CCGGGACCTAGTGGAATGGGTAAATCTCGAGATTTACCCATTCCACTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021622.3-1162s21c1
Sequence:CCGGCCAGCTTCCAAAGTGACTGAACTCGAGTTCAGTCACTTTGGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2560s1c1
Sequence:CCGGCCAGCTTCCAAAGTGACTGAACTCGAGTTCAGTCACTTTGGAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2632s1c1
Sequence:CCGGGACCTAGTAGACTTGGACGATCTCGAGATCGTCCAAGTCTACTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-1658s1c1
Sequence:CCGGCAAAGGTTAGCGATGCTACTACTCGAGTAGTAGCATCGCTAACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-1759s1c1
Sequence:CCGGGACCTAGTGGAATGGGTAAATCTCGAGATTTACCCATTCCACTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021622.2-1713s1c1
Sequence:CCGGGAATGCAGGAATGAGGAAGTACTCGAGTACTTCCTCATTCCTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021622.2-2295s1c1
Sequence:CCGGGCACAGTTGGATTAAAGCAGTCTCGAGACTGCTTTAATCCAACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021622.2-2581s1c1
Sequence:CCGGCAAGCTCTGTTAAGACCTCAACTCGAGTTGAGGTCTTAACAGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133942
VALIDATED
PLEKHA1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-266s21c1
Sequence:CCGGGCCATTAAACTTACCTACATTCTCGAGAATGTAGGTAAGTTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-279s21c1
Sequence:CCGGCCTACATTTCAAAGGTACCAACTCGAGTTGGTACCTTTGAAATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-533s21c1
Sequence:CCGGGCTGGGTATTGTGTGAAGCAACTCGAGTTGCTTCACACAATACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-647s21c1
Sequence:CCGGCGGGTGATACCACTTAAAGAACTCGAGTTCTTTAAGTGGTATCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133942.1-1925s1c1
Sequence:CCGGCCTCCCAGATTATAGGATTATCTCGAGATAATCCTATAATCTGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-279s1c1
Sequence:CCGGCCTACATTTCAAAGGTACCAACTCGAGTTGGTACCTTTGAAATGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-266s1c1
Sequence:CCGGGCCATTAAACTTACCTACATTCTCGAGAATGTAGGTAAGTTTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-647s1c1
Sequence:CCGGCGGGTGATACCACTTAAAGAACTCGAGTTCTTTAAGTGGTATCACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133942.1-533s1c1
Sequence:CCGGGCTGGGTATTGTGTGAAGCAACTCGAGTTGCTTCACACAATACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133942
VALIDATED
PLEKHA1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-266s21c1
Sequence:CCGGGCCATTAAACTTACCTACATTCTCGAGAATGTAGGTAAGTTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-279s21c1
Sequence:CCGGCCTACATTTCAAAGGTACCAACTCGAGTTGGTACCTTTGAAATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-533s21c1
Sequence:CCGGGCTGGGTATTGTGTGAAGCAACTCGAGTTGCTTCACACAATACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-647s21c1
Sequence:CCGGCGGGTGATACCACTTAAAGAACTCGAGTTCTTTAAGTGGTATCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133942.1-1925s1c1
Sequence:CCGGCCTCCCAGATTATAGGATTATCTCGAGATAATCCTATAATCTGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-279s1c1
Sequence:CCGGCCTACATTTCAAAGGTACCAACTCGAGTTGGTACCTTTGAAATGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-266s1c1
Sequence:CCGGGCCATTAAACTTACCTACATTCTCGAGAATGTAGGTAAGTTTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-647s1c1
Sequence:CCGGCGGGTGATACCACTTAAAGAACTCGAGTTCTTTAAGTGGTATCACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133942.1-533s1c1
Sequence:CCGGGCTGGGTATTGTGTGAAGCAACTCGAGTTGCTTCACACAATACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133942
VALIDATED
PLEKHA1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-266s21c1
Sequence:CCGGGCCATTAAACTTACCTACATTCTCGAGAATGTAGGTAAGTTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-279s21c1
Sequence:CCGGCCTACATTTCAAAGGTACCAACTCGAGTTGGTACCTTTGAAATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-533s21c1
Sequence:CCGGGCTGGGTATTGTGTGAAGCAACTCGAGTTGCTTCACACAATACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133942.2-647s21c1
Sequence:CCGGCGGGTGATACCACTTAAAGAACTCGAGTTCTTTAAGTGGTATCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133942.1-1925s1c1
Sequence:CCGGCCTCCCAGATTATAGGATTATCTCGAGATAATCCTATAATCTGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-279s1c1
Sequence:CCGGCCTACATTTCAAAGGTACCAACTCGAGTTGGTACCTTTGAAATGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-266s1c1
Sequence:CCGGGCCATTAAACTTACCTACATTCTCGAGAATGTAGGTAAGTTTAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133942.1-647s1c1
Sequence:CCGGCGGGTGATACCACTTAAAGAACTCGAGTTCTTTAAGTGGTATCACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133942.1-533s1c1
Sequence:CCGGGCTGGGTATTGTGTGAAGCAACTCGAGTTGCTTCACACAATACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)