EMAIL THIS PAGE TO A FRIEND

PLEKHA2

pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2

56 Gene Product Result for
Synonyms: TAPP2
UniProtKB ID: Q9HB19
Gene ID:
Mouse(83436) pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Rat(684785) pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
cow(530879) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
sheep(101114491) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
domestic guinea pig(100729139) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
naked mole-rat(101696907) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
chicken(395435) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
domestic cat(101085370) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
dog(482851) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021623 Rosetta Predictions human pricing
XM_496973 Rosetta Predictions human pricing
XM_931864 Rosetta Predictions human pricing
XM_001071937 Rosetta Predictions rat pricing
NM_031257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354963 predicted 1189
2 SASI_Hs02_00354964 predicted 951
3 SASI_Hs02_00354965 predicted 940
4 SASI_Hs02_00354966 predicted 1046
5 SASI_Hs02_00354967 predicted 886
6 SASI_Hs02_00354968 predicted 955
7 SASI_Hs02_00354969 predicted 866
8 SASI_Hs02_00354970 predicted 1057
9 SASI_Hs02_00354971 predicted 894
10 SASI_Hs02_00354972 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292723 predicted 1112
2 SASI_Hs01_00292724 predicted 869
3 SASI_Hs01_00292725 predicted 862
4 SASI_Hs01_00292726 predicted 971
5 SASI_Hs01_00292727 predicted 869
6 SASI_Hs01_00292728 predicted 793
7 SASI_Hs01_00292729 predicted 981
8 SASI_Hs01_00292730 predicted 944
9 SASI_Hs01_00292731 predicted 813
10 SASI_Hs01_00292732 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272749 predicted 536
2 SASI_Hs01_00272750 predicted 657
3 SASI_Hs01_00272751 predicted 516
4 SASI_Hs01_00272752 predicted 494
5 SASI_Hs01_00272753 predicted 1328
6 SASI_Hs01_00272754 predicted 890
7 SASI_Hs01_00272755 predicted 1281
8 SASI_Hs01_00272756 predicted 866
9 SASI_Hs01_00272757 predicted 892
10 SASI_Hs01_00272758 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337066 predicted 297
2 SASI_Rn02_00337067 predicted 353
3 SASI_Rn02_00337068 predicted 407
4 SASI_Rn02_00337069 predicted 923
5 SASI_Rn02_00337070 predicted 459
6 SASI_Rn02_00337071 predicted 844
7 SASI_Rn02_00337072 predicted 354
8 SASI_Rn02_00337073 predicted 714
9 SASI_Rn02_00337074 predicted 430
10 SASI_Rn02_00337075 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062599 predicted 1633
2 SASI_Mm01_00062600 predicted 859
3 SASI_Mm01_00062601 predicted 1440
4 SASI_Mm02_00337083 predicted 1316
5 SASI_Mm01_00062602 predicted 449
6 SASI_Mm01_00062603 predicted 377
7 SASI_Mm01_00062604 predicted 1491
8 SASI_Mm01_00062606 predicted 1074
9 SASI_Mm01_00062607 predicted 422
10 SASI_Mm01_00062608 predicted 1530
11 SASI_Mm01_00062605 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031257
VALIDATED
PLEKHA2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031257.2-429s1c1
Sequence:CCGGCAGCAAGATCACTGTACCCAACTCGAGTTGGGTACAGTGATCTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031257.2-2874s21c1
Sequence:CCGGGCTAGGTAAATTAACCCTGTTCTCGAGAACAGGGTTAATTTACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-328s21c1
Sequence:CCGGACACCATTCTGCTTCGTTATCCTCGAGGATAACGAAGCAGAATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-887s21c1
Sequence:CCGGACAACCTGTTTGAAATCATAACTCGAGTTATGATTTCAAACAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-2874s1c1
Sequence:CCGGGCTAGGTAAATTAACCCTGTTCTCGAGAACAGGGTTAATTTACCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-1073s1c1
Sequence:CCGGCGCCTAACTCCATCTTGTCAACTCGAGTTGACAAGATGGAGTTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031257.2-2468s1c1
Sequence:CCGGGCCCACTTGCTCTTTGCTTTACTCGAGTAAAGCAAAGAGCAAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-762s1c1
Sequence:CCGGCGATGACTTTACCATCTGCTACTCGAGTAGCAGATGGTAAAGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031257.2-1049s1c1
Sequence:CCGGCTGGAAGTTCTACCCTTACAACTCGAGTTGTAAGGGTAGAACTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031257.2-163s21c1
Sequence:CCGGGGCAAATTCCTCCGGAGATACCTCGAGGTATCTCCGGAGGAATTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-1073s21c1
Sequence:CCGGCGCCTAACTCCATCTTGTCAACTCGAGTTGACAAGATGGAGTTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031257
VALIDATED
PLEKHA2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031257.2-429s1c1
Sequence:CCGGCAGCAAGATCACTGTACCCAACTCGAGTTGGGTACAGTGATCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031257.2-2874s21c1
Sequence:CCGGGCTAGGTAAATTAACCCTGTTCTCGAGAACAGGGTTAATTTACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-328s21c1
Sequence:CCGGACACCATTCTGCTTCGTTATCCTCGAGGATAACGAAGCAGAATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-887s21c1
Sequence:CCGGACAACCTGTTTGAAATCATAACTCGAGTTATGATTTCAAACAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-2874s1c1
Sequence:CCGGGCTAGGTAAATTAACCCTGTTCTCGAGAACAGGGTTAATTTACCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-1073s1c1
Sequence:CCGGCGCCTAACTCCATCTTGTCAACTCGAGTTGACAAGATGGAGTTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031257.2-2468s1c1
Sequence:CCGGGCCCACTTGCTCTTTGCTTTACTCGAGTAAAGCAAAGAGCAAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-762s1c1
Sequence:CCGGCGATGACTTTACCATCTGCTACTCGAGTAGCAGATGGTAAAGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031257.2-1049s1c1
Sequence:CCGGCTGGAAGTTCTACCCTTACAACTCGAGTTGTAAGGGTAGAACTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031257.2-163s21c1
Sequence:CCGGGGCAAATTCCTCCGGAGATACCTCGAGGTATCTCCGGAGGAATTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-1073s21c1
Sequence:CCGGCGCCTAACTCCATCTTGTCAACTCGAGTTGACAAGATGGAGTTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031257
VALIDATED
PLEKHA2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031257.2-429s1c1
Sequence:CCGGCAGCAAGATCACTGTACCCAACTCGAGTTGGGTACAGTGATCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031257.2-2874s21c1
Sequence:CCGGGCTAGGTAAATTAACCCTGTTCTCGAGAACAGGGTTAATTTACCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-328s21c1
Sequence:CCGGACACCATTCTGCTTCGTTATCCTCGAGGATAACGAAGCAGAATGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-887s21c1
Sequence:CCGGACAACCTGTTTGAAATCATAACTCGAGTTATGATTTCAAACAGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-2874s1c1
Sequence:CCGGGCTAGGTAAATTAACCCTGTTCTCGAGAACAGGGTTAATTTACCTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-1073s1c1
Sequence:CCGGCGCCTAACTCCATCTTGTCAACTCGAGTTGACAAGATGGAGTTAGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031257.2-2468s1c1
Sequence:CCGGGCCCACTTGCTCTTTGCTTTACTCGAGTAAAGCAAAGAGCAAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031257.2-762s1c1
Sequence:CCGGCGATGACTTTACCATCTGCTACTCGAGTAGCAGATGGTAAAGTCATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031257.2-1049s1c1
Sequence:CCGGCTGGAAGTTCTACCCTTACAACTCGAGTTGTAAGGGTAGAACTTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031257.2-163s21c1
Sequence:CCGGGGCAAATTCCTCCGGAGATACCTCGAGGTATCTCCGGAGGAATTTGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031257.2-1073s21c1
Sequence:CCGGCGCCTAACTCCATCTTGTCAACTCGAGTTGACAAGATGGAGTTAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021623
VALIDATED
PLEKHA2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-1450s21c1
Sequence:CCGGCCCAAGGAGAAGCCGTTTATGCTCGAGCATAAACGGCTTCTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-3131s21c1
Sequence:CCGGATACTTGGAGCGGCATGATTTCTCGAGAAATCATGCCGCTCCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-1087s21c1
Sequence:CCGGGACATGCACAGCTGGATTAAGCTCGAGCTTAATCCAGCTGTGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-943s21c1
Sequence:CCGGGAACCACTGCGCACCATATTTCTCGAGAAATATGGTGCGCAGTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-290s21c1
Sequence:CCGGATGAGAACAGCGGCAAGTTTCCTCGAGGAAACTTGCCGCTGTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021623
VALIDATED
PLEKHA2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-1450s21c1
Sequence:CCGGCCCAAGGAGAAGCCGTTTATGCTCGAGCATAAACGGCTTCTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-3131s21c1
Sequence:CCGGATACTTGGAGCGGCATGATTTCTCGAGAAATCATGCCGCTCCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-1087s21c1
Sequence:CCGGGACATGCACAGCTGGATTAAGCTCGAGCTTAATCCAGCTGTGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-943s21c1
Sequence:CCGGGAACCACTGCGCACCATATTTCTCGAGAAATATGGTGCGCAGTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-290s21c1
Sequence:CCGGATGAGAACAGCGGCAAGTTTCCTCGAGGAAACTTGCCGCTGTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021623
VALIDATED
PLEKHA2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-1450s21c1
Sequence:CCGGCCCAAGGAGAAGCCGTTTATGCTCGAGCATAAACGGCTTCTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-3131s21c1
Sequence:CCGGATACTTGGAGCGGCATGATTTCTCGAGAAATCATGCCGCTCCAAGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-1087s21c1
Sequence:CCGGGACATGCACAGCTGGATTAAGCTCGAGCTTAATCCAGCTGTGCATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-943s21c1
Sequence:CCGGGAACCACTGCGCACCATATTTCTCGAGAAATATGGTGCGCAGTGGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021623.1-290s21c1
Sequence:CCGGATGAGAACAGCGGCAAGTTTCCTCGAGGAAACTTGCCGCTGTTCTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)