EMAIL THIS PAGE TO A FRIEND

PLEKHA3

pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3

147 Gene Product Result for
Synonyms: FAPP1
UniProtKB ID: Q9HB20, Q4ZG69, Q86TQ1, Q9NXT3
Gene ID:
Mouse(83435) pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3
Rat(295674) pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3
Zebrafish(394182) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
domestic cat(101095359) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
dog(488425) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
chicken(424128) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
naked mole-rat(101704442) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
domestic guinea pig(100724704) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
cow(509423) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
sheep(101123096) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019091 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019091 Rosetta Predictions human pricing
NM_001013077 Rosetta Predictions rat pricing
NM_031256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016597 predicted 862
2 SASI_Hs02_00352701 predicted 911
3 SASI_Hs01_00016598 predicted 712
4 SASI_Hs01_00016599 predicted 1142
5 SASI_Hs01_00016600 predicted 1165
6 SASI_Hs01_00016601 predicted 573
7 SASI_Hs02_00352702 predicted 1200
8 SASI_Hs01_00016603 predicted 883
9 SASI_Hs01_00016604 predicted 902
10 SASI_Hs01_00016605 predicted 885
11 SASI_Hs01_00016596 predicted 1279
12 SASI_Hs01_00016602 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045190 predicted 420
2 SASI_Rn01_00045191 predicted 409
3 SASI_Rn01_00045192 predicted 778
4 SASI_Rn02_00200708 predicted 971
5 SASI_Rn01_00045193 predicted 728
6 SASI_Rn01_00045194 predicted 655
7 SASI_Rn01_00045195 predicted 310
8 SASI_Rn01_00045196 predicted 798
9 SASI_Rn02_00200709 predicted 439
10 SASI_Rn02_00200710 predicted 336
11 SASI_Rn01_00045197 predicted 1050
12 SASI_Rn01_00045198 predicted 748
13 SASI_Rn01_00045199 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065184 predicted 604
2 SASI_Mm01_00065185 predicted 857
3 SASI_Mm02_00337081 predicted 801
4 SASI_Mm01_00065186 predicted 929
5 SASI_Mm02_00337082 predicted 524
6 SASI_Mm01_00065188 predicted 546
7 SASI_Mm01_00065189 predicted 310
8 SASI_Mm01_00065190 predicted 873
9 SASI_Mm01_00065191 predicted 815
10 SASI_Mm01_00065192 predicted 449
11 SASI_Mm01_00065187 predicted 494
12 SASI_Mm01_00065193 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031256
VALIDATED
PLEKHA3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-814s21c1
Sequence:CCGGCGCCAAGTTTAAACCTGAGATCTCGAGATCTCAGGTTTAAACTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-332s21c1
Sequence:CCGGCGATGGTTTGTTCTGGATAATCTCGAGATTATCCAGAACAAACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-450s21c1
Sequence:CCGGACAACACAAGAATGGAGTTAACTCGAGTTAACTCCATTCTTGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031256.3-1611s21c1
Sequence:CCGGGCCAGATTTATTTGACAGAAACTCGAGTTTCTGTCAAATAAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031256.2-1420s1c1
Sequence:CCGGGCCAGATTTATTTGACAGAAACTCGAGTTTCTGTCAAATAAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-622s1c1
Sequence:CCGGCGCCAAGTTTAAACCTGAGATCTCGAGATCTCAGGTTTAAACTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-258s1c1
Sequence:CCGGACAACACAAGAATGGAGTTAACTCGAGTTAACTCCATTCTTGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031256.2-573s1c1
Sequence:CCGGCCTGTAACACATTCATCACAACTCGAGTTGTGATGAATGTGTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-140s1c1
Sequence:CCGGCGATGGTTTGTTCTGGATAATCTCGAGATTATCCAGAACAAACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-765s21c1
Sequence:CCGGCCTGTAACACATTCATCACAACTCGAGTTGTGATGAATGTGTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031256
VALIDATED
PLEKHA3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-814s21c1
Sequence:CCGGCGCCAAGTTTAAACCTGAGATCTCGAGATCTCAGGTTTAAACTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-332s21c1
Sequence:CCGGCGATGGTTTGTTCTGGATAATCTCGAGATTATCCAGAACAAACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-450s21c1
Sequence:CCGGACAACACAAGAATGGAGTTAACTCGAGTTAACTCCATTCTTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031256.3-1611s21c1
Sequence:CCGGGCCAGATTTATTTGACAGAAACTCGAGTTTCTGTCAAATAAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031256.2-1420s1c1
Sequence:CCGGGCCAGATTTATTTGACAGAAACTCGAGTTTCTGTCAAATAAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-622s1c1
Sequence:CCGGCGCCAAGTTTAAACCTGAGATCTCGAGATCTCAGGTTTAAACTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-258s1c1
Sequence:CCGGACAACACAAGAATGGAGTTAACTCGAGTTAACTCCATTCTTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031256.2-573s1c1
Sequence:CCGGCCTGTAACACATTCATCACAACTCGAGTTGTGATGAATGTGTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-140s1c1
Sequence:CCGGCGATGGTTTGTTCTGGATAATCTCGAGATTATCCAGAACAAACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-765s21c1
Sequence:CCGGCCTGTAACACATTCATCACAACTCGAGTTGTGATGAATGTGTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031256
VALIDATED
PLEKHA3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-814s21c1
Sequence:CCGGCGCCAAGTTTAAACCTGAGATCTCGAGATCTCAGGTTTAAACTTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-332s21c1
Sequence:CCGGCGATGGTTTGTTCTGGATAATCTCGAGATTATCCAGAACAAACCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-450s21c1
Sequence:CCGGACAACACAAGAATGGAGTTAACTCGAGTTAACTCCATTCTTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031256.3-1611s21c1
Sequence:CCGGGCCAGATTTATTTGACAGAAACTCGAGTTTCTGTCAAATAAATCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031256.2-1420s1c1
Sequence:CCGGGCCAGATTTATTTGACAGAAACTCGAGTTTCTGTCAAATAAATCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-622s1c1
Sequence:CCGGCGCCAAGTTTAAACCTGAGATCTCGAGATCTCAGGTTTAAACTTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-258s1c1
Sequence:CCGGACAACACAAGAATGGAGTTAACTCGAGTTAACTCCATTCTTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031256.2-573s1c1
Sequence:CCGGCCTGTAACACATTCATCACAACTCGAGTTGTGATGAATGTGTTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031256.2-140s1c1
Sequence:CCGGCGATGGTTTGTTCTGGATAATCTCGAGATTATCCAGAACAAACCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031256.3-765s21c1
Sequence:CCGGCCTGTAACACATTCATCACAACTCGAGTTGTGATGAATGTGTTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019091
VALIDATED
PLEKHA3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-751s1c1
Sequence:CCGGGAATGTGTGAAGATAGCCAATCTCGAGATTGGCTATCTTCACACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-362s1c1
Sequence:CCGGGAAGCATAAAGATGGCAGTTTCTCGAGAAACTGCCATCTTTATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1109s1c1
Sequence:CCGGCAGAAGATACTCTTCCATCCTCTCGAGAGGATGGAAGAGTATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-610s1c1
Sequence:CCGGGACCTCTTAATGCAGCAAGTTCTCGAGAACTTGCTGCATTAAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-559s1c1
Sequence:CCGGGAAACCAGTGAATCGCTGAAACTCGAGTTTCAGCGATTCACTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1037s1c1
Sequence:CCGGCACTTAATGGAGATTTGGCATCTCGAGATGCCAAATCTCCATTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1048s1c1
Sequence:CCGGGATTTGGCATCAGCAACCATTCTCGAGAATGGTTGCTGATGCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019091
VALIDATED
PLEKHA3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-751s1c1
Sequence:CCGGGAATGTGTGAAGATAGCCAATCTCGAGATTGGCTATCTTCACACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-362s1c1
Sequence:CCGGGAAGCATAAAGATGGCAGTTTCTCGAGAAACTGCCATCTTTATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1109s1c1
Sequence:CCGGCAGAAGATACTCTTCCATCCTCTCGAGAGGATGGAAGAGTATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-610s1c1
Sequence:CCGGGACCTCTTAATGCAGCAAGTTCTCGAGAACTTGCTGCATTAAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-559s1c1
Sequence:CCGGGAAACCAGTGAATCGCTGAAACTCGAGTTTCAGCGATTCACTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1037s1c1
Sequence:CCGGCACTTAATGGAGATTTGGCATCTCGAGATGCCAAATCTCCATTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1048s1c1
Sequence:CCGGGATTTGGCATCAGCAACCATTCTCGAGAATGGTTGCTGATGCCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019091
VALIDATED
PLEKHA3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-751s1c1
Sequence:CCGGGAATGTGTGAAGATAGCCAATCTCGAGATTGGCTATCTTCACACATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-362s1c1
Sequence:CCGGGAAGCATAAAGATGGCAGTTTCTCGAGAAACTGCCATCTTTATGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1109s1c1
Sequence:CCGGCAGAAGATACTCTTCCATCCTCTCGAGAGGATGGAAGAGTATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-610s1c1
Sequence:CCGGGACCTCTTAATGCAGCAAGTTCTCGAGAACTTGCTGCATTAAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019091.2-559s1c1
Sequence:CCGGGAAACCAGTGAATCGCTGAAACTCGAGTTTCAGCGATTCACTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1037s1c1
Sequence:CCGGCACTTAATGGAGATTTGGCATCTCGAGATGCCAAATCTCCATTAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019091.2-1048s1c1
Sequence:CCGGGATTTGGCATCAGCAACCATTCTCGAGAATGGTTGCTGATGCCAAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)